Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
endoplasmic reticulum
justify the claim that paramecium is the highly evolved protozoan basing on the morphological and physiological features .
organism that have wide tolerance range
State the term- Hue Hue is the dominant spectral colour (rainbow) and is related to the wavelength of light. In Munsell system there are five principal hues; red (R), yellow (
Define Water - Important Nutrient? Macronutrients, you know, are those nutrients which are required in large amounts by our body namely, carbohydrates, fats and proteins. We st
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define the density of egg The density of egg products is not affected by dehydration. When a dried egg product is reconstituted to its natural solids, it has about the same d
A biologist examines a series of cells and counts 140 cells in interphase, 10 cells in metaphase, 4 cells in anaphase and 7 cells in telophase. if complete cell cycle requires 24 h
Define about the Food Production? We know that agriculture comprises the major source of food production. This is very true in a country like ours where the majority of the pop
Q. Procedures Adopted by Numerical Taxonomists? Since numerical taxonomy is an operational science, the procedure is divided into a number of repeatable steps, allowing the res
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd