Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Micro-organisms:
The micro-organisms mixed up in aerobic absorption and their activities are the same as those found in nature. The organic compounds are oxidised to H2O and CO2, and nitrogenous elements and biomass are also created. However in waste water, the organic materials are present in much larger concentrations than in nature. so, the microbial population and activities are gained accordingly by (i) giving large surface for bio film creation and O2 exchange in fixed film structures, basically trickling filters, and (ii) returning a type of the operated sludge to the digester vessel and creating effective aeration arrangements.
Q. What do you mean by Binomial system in binomial nomenclature? In the previous sections we have outlined the concepts of binomial nomenclature at International level and the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
INTRODUCTIO N - Endocrinolog y - Study of endocrine glands, hormones and their effects. Thomas Addison - Father of endocrinology. Described hormonal disease in 1855 kn
Describe Oxidative Stress in New Cardio-vascular Risk Factors ? In the risk conferred by LDL cholesterol, the oxidative modification of LDL plays a central role, because it is
The highest possible magnification that can obtain when using using a microscope?
Q. What are the digestive functions of the liver? The liver has other digestive functions, besides making bile for release in the duodenum. The venous network that absorbs n
How is energy transferred along a food chain? The energy flux beside a food chain is always unidirectional, from the producers to the decomposers.
EXCRETIO N IN AMOEBA - NH 3 is excreted out through plasmalemma. Osmoregulation takes place by contractile vacoule, generally one, towards posterior end, contractile in
What are the principal sources of excessive nitrate and phosphate in rivers and lakes?
Activators Activity of many enzymes is influenced by certain ions called as activators. Large number of enzymes such as hexokinase that require ATF are also in need of diva
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd