Micro-organisms, Biology

Assignment Help:

Micro-organisms:

The micro-organisms mixed up in aerobic absorption and their activities are the same as those found in nature. The organic compounds are oxidised to H2O and CO2, and nitrogenous elements and biomass are also created. However in waste water, the organic materials are present in much larger concentrations than in nature. so, the microbial population and activities are gained accordingly by (i) giving large surface for bio film creation and O2 exchange in fixed film structures, basically trickling filters, and (ii) returning a type of the operated sludge to the digester vessel and creating effective aeration arrangements.


Related Discussions:- Micro-organisms

Taxonomy, Agroup of realated genera are classified as-?

Agroup of realated genera are classified as-?

Haccp plan, HACCP  Plan  :  The written document which  is  based upon the...

HACCP  Plan  :  The written document which  is  based upon the principles  of  HACCP  and which delineates  the procedures  to  be  followed.

The effect of gravity on roots, The effect of gravity on roots Cut vari...

The effect of gravity on roots Cut various pieces of blotting paper about 8 cm square. Place these among two squares of glass. Place several radish or mustard seeds among the b

Nucleoplasm, NUCLEOPLAS M OR KARYOPLASM OR KARYOLYMPH OR NUCLEAR SAP N...

NUCLEOPLAS M OR KARYOPLASM OR KARYOLYMPH OR NUCLEAR SAP Nucleoplasm and cytoplasm name proposed by E. Strassburger . Chemical composition of nucleoplasm given by Kossel . Co

How does sexual reproduction occur in bacteria, How does sexual reproductio...

How does sexual reproduction occur in bacteria? How different are the modalities of bacterial sexual reproduction? Sexual reproduction happens when bacteria incorporate genetic

Assessment of peripheral vascular perfusion (beside test), Assessment of Pe...

Assessment of Peripheral Vascular Perfusion (Beside Test) Burger's Postural Test Perform in daylight.  Place patient supine with both legs elevated and knees

Why iodine is important for human body, Why Iodine is Important for Human B...

Why Iodine is Important for Human Body? Iodine is an essential constituent of the thyroid hormones: thyroxine (T 4 ) and triiodothyronine (T 3 ), which have a key role in growt

Structure of chromosome, STRUCTURE Each chromosome composed of two i...

STRUCTURE Each chromosome composed of two interwoven (coiled) threads called Chromonema (Chromonemata) embeded in a matrix of semisolid protein. Surface of matrix is in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define precautions for estimation of vitamin c in a solution, Define Precau...

Define Precautions for estimation of vitamin c in a solution? 1. Rinse all glassware with 3% metaphosphoric acid before you begin your practical and subsequently each time you

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd