Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Micro-organisms:
The micro-organisms mixed up in aerobic absorption and their activities are the same as those found in nature. The organic compounds are oxidised to H2O and CO2, and nitrogenous elements and biomass are also created. However in waste water, the organic materials are present in much larger concentrations than in nature. so, the microbial population and activities are gained accordingly by (i) giving large surface for bio film creation and O2 exchange in fixed film structures, basically trickling filters, and (ii) returning a type of the operated sludge to the digester vessel and creating effective aeration arrangements.
Agroup of realated genera are classified as-?
HACCP Plan : The written document which is based upon the principles of HACCP and which delineates the procedures to be followed.
The effect of gravity on roots Cut various pieces of blotting paper about 8 cm square. Place these among two squares of glass. Place several radish or mustard seeds among the b
NUCLEOPLAS M OR KARYOPLASM OR KARYOLYMPH OR NUCLEAR SAP Nucleoplasm and cytoplasm name proposed by E. Strassburger . Chemical composition of nucleoplasm given by Kossel . Co
How does sexual reproduction occur in bacteria? How different are the modalities of bacterial sexual reproduction? Sexual reproduction happens when bacteria incorporate genetic
Assessment of Peripheral Vascular Perfusion (Beside Test) Burger's Postural Test Perform in daylight. Place patient supine with both legs elevated and knees
Why Iodine is Important for Human Body? Iodine is an essential constituent of the thyroid hormones: thyroxine (T 4 ) and triiodothyronine (T 3 ), which have a key role in growt
STRUCTURE Each chromosome composed of two interwoven (coiled) threads called Chromonema (Chromonemata) embeded in a matrix of semisolid protein. Surface of matrix is in
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Precautions for estimation of vitamin c in a solution? 1. Rinse all glassware with 3% metaphosphoric acid before you begin your practical and subsequently each time you
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd