Methods of virus, Biology

Assignment Help:

How Viruses Multiply?

Obligatory parasitism - Outside cells viruses are nonliving, inactive   particles but after entering into live cells these multiply fast by replication  like organism  thus these represent obligatory parasitism; these can be defined as inanimate obligatory parasites Obviously, these have their own hereditary blueprint for replication, but no machinery to use the genome. After the cellular metabolic machinery to obey their genome for their own replication thus their genome is the basic infectious material.

Host-cell Cycle Viruses

The different stages form the contact of a virus with its host cell to the release  of its copies form the host cell constitute the host cell cycle  of a virus, It may  also be called replicative or parasitic cycle of the virus, but not its like cycle, because growth never occurs in a virus, simply  the components o fits several copied are synthesized  and assembled in the host cell

Early studies on viral replication began with bacteriophages .The complete host cell cycle comprises following six phases-

(1)    Adsorption (attachment of viron with host cell)-As a virion comes in contact with suitable host cell, it become attached upon host cell surface due interaction its attachment proteins and specific receptor proteins of host cell membrane.

(2)   Penetration-As mentioned before, a  bacteriophage  virion  leaves its capsid outside and injects only nucleic  acid filament ds (DNA)  into the host bacterium by using its tail as a hypodermic syringe the tail fibres  bend, and the spring like tail compresses to inject the viral genome through  a puncture in the rigid wall of the bacterium.

Most plant viruses enter whole into the host cells at points of injuries' upon leaf surfaces, or these are inoculated into plant cells by arthropod   vectors,

Animal's viruses also enter whole into cells. Three types of penetration mechanisms have been described in their case---  

(1)   Direct passage --- No enveloped vir ions reach into host cell cytoplasm by simply pushing through the host cell membrane.

(2)   Fusion -The  envelope of some enveloped viruses fuses with host cell membrane,  becoming continuous with it and thus releasing the nucleocapsid into hast cell cytoplasm.

(3)   Endocytosis  - The virion, in this case is actively engulfed by the host cell by a process  resembling phagocytosis so that it is  enclosed in a vacuole or vesicle when it reaches into the cytoplasm of host cell .

(4)   Uncoating -Within the host cell, all of a virion except its genome and enzymes associated with  the genome, is digested by lysosmal  enzymes of the host cell

(5)   Biosynthesis - This phase includes replication of viral genome and synthesis of viral proteins, as well as the enzymatic proteins required for inactivation of host cell genome, and for initiation, regulation and control of viral synthesis, assembly and release. Replication   of viral genome of most DNA viruses is replicated in host cell cytoplasm. Viral proteins are always synthesized in host cell cytoplasm.

(6)   Maturation - This comprises assembly of viral components into progeny virions, It occurs in host cell nucleus or cytoplasm. In case of enveloped viruses, the envelope is respectively derived from nuclear and cell membranes.

(7)   Release-Usually, quite a large number of progeny viruses are formed in the host cell.  In case of bacteriophages,, progeny viruses are released by lysis of  host bacterium. In case of animal's viruses, progeny viruses are generally released by budding from host cell surface.

(8)   The   host cell cycle is completed in about 15 to 30 minutes in case of bactrio  phages, but in 15to30 hours in case  of animals viruses ,The progeny viruses, released from host cells attack fresh host cells in the infected  tissues.


Related Discussions:- Methods of virus

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Where can rna are found within cells, Q. Where can RNA are found within cel...

Q. Where can RNA are found within cells? In the eukaryote cell nucleus the RNA can be found to dispersed in the nuclear fluid, along with the DNA, and as the main constituent o

Explain the properties of gum arabic, Properties Gum Arabic is unique b...

Properties Gum Arabic is unique between the natural hydrocolloids because of its extremely high solubility in water and can yield solutions of up to 55% concentrations. Solutio

Define the diet for children, Define the Diet for Children? By preschoo...

Define the Diet for Children? By preschool stage, their routines are set' and dietary choices become more and more firm by the time they are in senior school. Further, there is

What are the uses of whey protein concentrates, What are the uses of whey p...

What are the uses of whey protein concentrates? Whey protein concentrates are used extensively in the manufacture of baked goods, where they increase the effectiveness of short

Will argon tend to form bonds with other elements, The atomic number of arg...

The atomic number of argon is 18. Will argon tend to form bonds with other elements? Describe your answer. Argon will not tend to form bonds with other elements. With an atomi

What is gene, What is gene? Gene is a sequence of DNA nucleotides that ...

What is gene? Gene is a sequence of DNA nucleotides that codifies the production of a protein.

Assisting in procedure of biopsy, ASSISTING IN PROCEDURE OF BIOPSY Bio...

ASSISTING IN PROCEDURE OF BIOPSY Biopsies are removal of a small piece of tissue for examination under microscope. Such examinations are called hist to pathological examina

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd