Methods by which diseases are transmitted, Biology

Assignment Help:

There are several methods by which a disease-causing organism can be transferred from the reservoir to the host organism.

Direct contact : Disease - causing organism may be transferred immediatly from reservoir or carrier to a healthy person by direct physical contact. This type of transfer is seen in diseases where the disease - causing organism cannot live for a longer time outside the body of human host. Diseases like skin and eye infections are transferred by direct physical contact.

Droplet infection : Droplets of saliva are sprayed out when we cough, sneeze or spit. These salivary droplets from sick person contain the disease-causing organisms. These salivary droplets act as a source of infection for others. Diseases like mumps, influenza, measles, chicken pox, common cold, whooping cough and tuberculosis are transmitted in this manner.

Vehicle borne transmission : In this mode of transmission, the disease-causing organism is transmitted through another living animal which is called as VECTOR. In several cases, the vectors are insects and rats or mice. Diseases such as plague, malaria are transmitted in this manner. Carriers play a very important role in the transmission of a disease. The carrier appears normal but is infected with a disease- causing organism.

Airborne transmission : Air acts as a carrier or vehicle for transferring some of the disease causing organisms. These may be released when a sick person coughs, spits, sneezes. Deseases such as tuberculosis, influenza, chickenpox, measles etc., are transmitted in this manner. 

Unhygienic habits : Eating food without washing hands, eating food or drinking water from unhygienic sources also causes the transfer of disease-causing organisms.


Related Discussions:- Methods by which diseases are transmitted

Define the techniques of instrument retrieval, Define the Techniques of Ins...

Define the Techniques of Instrument Retrieval Endo Extractor (Brasseler) a. Hollow tube bonded to coronal tip of separated instrument by cyanoacrylate adhesive, with

Animals of the open water zone, Animals of the open water zone The li...

Animals of the open water zone The limnetic region of this zone contains certain fishes as well as rotifers, zooplankton such as crustacean and protozoan. In the profundal zo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Mixed aortic stenosis and regurgitation, Mixed Aortic Stenosis and Regu...

Mixed Aortic Stenosis and Regurgitation :  The combined aortic valve stenosis and regurgitation may be of congenital or acquired aetiology, as in aortic stenosis. Most common

Explain about the fat metabolism - ageing, Explain about the Fat metabolism...

Explain about the Fat metabolism - Ageing? With increasing age, the blood cholesterol and blood triglyceride levels gradually increase. Certain factors like the kind and amoun

Show the physical criteria of quality for honey, Q. Show the Physical crite...

Q. Show the Physical criteria of quality for Honey? Colour, crystallization, pH, acidity, water content are some of the criteria used for analysis of honey. These criteria are

What are gene chips, Question  Write a short note on the following 1 St...

Question  Write a short note on the following 1 Stem cells 2 Edible vaccines 3 Biologic Materials 4 Liposomes 5 What are gene chips? Explain any 4 applications of g

Define reagent required and methodology for barfoed test, Define reagent re...

Define reagent required and methodology for Barfoed Test? Reagents - Solutions of glucose, fructose, galactose, lactose, maltose, sucrose and starch - Barfoed's reagent

Extinction, EXTINCTIO N  - It refers to disappearance of a species from...

EXTINCTIO N  - It refers to disappearance of a species from earth when its last surviving member dies. Organic evolution not only creats new sps. but also eliminates some ol

Explain coronaw artery disease, Explain CORONAW ARTERY DISEASE (CAD)? A...

Explain CORONAW ARTERY DISEASE (CAD)? As far as CAD is concerned the people of South Asian region are at a very disadvantageous position. The term 'South Asians' includes perso

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd