Metaphase chromosomes, Biology

Assignment Help:

Metaphase chromosomes:

Each metaphase chromosomes is a duplicated structure which consists of two sister chromatids, attached at a point called centromere or primary constriction. The centromere has special area the kinetochore, with specific base arrangement and special proteins where kinetochore fibers of mitotic apparatus attach.


Related Discussions:- Metaphase chromosomes

Taxonomy, A In taxonomy, what is a "KEY" ? List the different types of key...

A In taxonomy, what is a "KEY" ? List the different types of keys. How are they prepared and what are they used for ?sk question #Minimum 100 words accepted#

What are atherosclerosis, Atherosclerosis, the most common part of hardenin...

Atherosclerosis, the most common part of hardening of the arteries, is characterized by the presence of cholesterol-rich arterial thickenings (atheromas).  This progressive  diseas

Nutrition, what is non conventional feed

what is non conventional feed

Kingdom animalia, critera for the animal classification

critera for the animal classification

Blood collection, Blood Collection: Blood for analysis may be obtained...

Blood Collection: Blood for analysis may be obtained from veins, arteries, or capillaries. Venous blood is usually the specimen of choice, and venipuncture is the method for

Cell coat, what is the job of the cell coat?

what is the job of the cell coat?

Determine some assessment measures of zinc, Determine some assessment measu...

Determine some assessment measures of Zinc? Measurement of zinc in plasma: This is the most common method. Fasting concentrations of less than 70 μg/litre suggests deficie

Structure and function of triacylglycerols , Triacylglycerols  which is als...

Triacylglycerols  which is also  known as  triglycerides or fats  consist  of  three  fatty  acid chains  esterified  to  a  glycerol  backbone.  Simple  triacylglycerols   have  t

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by digestive enzymes, Q. Besides the pancreatic juice in t...

Q. Besides the pancreatic juice in the intestine there is the releasing of the enteric juice that contains digestive enzymes too. What are these enzymes and which type of molecule

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd