Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Mechanics of Locomotion
Among annelids, polychaetes, hence more primitive than the other two groups, show a more complex mode of locomotion. Necessarily, the locomotion in polychaetes is dependent on the antagonistic action of muscles on either side. While the longitudinal muscles of one side of a segment are contracted, those of the opposite side are in a fully stretched or relaxed state. In this type of way, a series of waves can be formed along the whole body of the animal. Polychaetes exhibit various types of locomotion.
Spring overturn - Overturn In spring and early summer season the increased solar radiation melts the ice cover, which, as it attains a temperature of 4° Celsius, becomes dense
detail about cytoplas
Which of the following properties of dsDNA is imprtant for DNA purification? A. Hydrophilic B. Positively charged phosphate backbone C. Can only bind to divalent cations
What is the constitution of the cartilaginous matrix? The cartilaginous matrix is made of collagen fibers, mostly collagen type II, and of proteoglycans, proteins associated to
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe the Complete transposition of great arteries ? Lethal, relatively frequent malformation. Without treatment, it results in 30 per cent mortality within the first week o
Evaluation of feedstuff In the feed manufacturing process evaluation of the feed ingredients is very important in achieving consistent quality throughout the year. If one is a
Explain the Primary Root Growth? Primary Growth in Roots : Roots grow down and through the soil by adding new cells at the tip of the root (called the root tip). There is a
Based on the simplified two-gene model for eye colour, explain using genotypes how two blue-eyed parents could produce a brown-eyed child. In what ways is genomic imprinting sim
Q. Can you explain about thoracic Aortography? Aortic arch angiography has been used to assess aortic valve or aortic root disease. Thoracic aortography is helpful for assessm
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd