Mechanics of locomotion, Biology

Assignment Help:

Mechanics of Locomotion

Among annelids, polychaetes, hence more primitive than the other two groups, show a more complex mode of locomotion. Necessarily, the locomotion in polychaetes is dependent on the antagonistic action of muscles on either side. While the longitudinal muscles of one side of a segment are contracted, those of the opposite side are in a fully stretched or relaxed state. In this type of way, a series of waves can be formed along the whole body of the animal. Polychaetes exhibit various types of locomotion.


Related Discussions:- Mechanics of locomotion

Spring overturn - overturn, Spring overturn - Overturn In spring and e...

Spring overturn - Overturn In spring and early summer season the increased solar radiation melts the ice cover, which, as it attains a temperature of 4° Celsius, becomes dense

Which dsdna is imprtant for dna purification, Which of the following proper...

Which of the following properties of dsDNA is imprtant for DNA purification? A. Hydrophilic B. Positively charged phosphate backbone C. Can only bind to divalent cations

What is the constitution of the cartilaginous matrix, What is the constitut...

What is the constitution of the cartilaginous matrix? The cartilaginous matrix is made of collagen fibers, mostly collagen type II, and of proteoglycans, proteins associated to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe the complete transposition of great arteries, Describe the Complet...

Describe the Complete transposition of great arteries ? Lethal, relatively frequent malformation. Without treatment, it results in 30 per cent mortality within the first week o

Agro industrial-evaluation of feedstuff, Evaluation of feedstuff In th...

Evaluation of feedstuff In the feed manufacturing process evaluation of the feed ingredients is very important in achieving consistent quality throughout the year. If one is a

Explain the primary root growth, Explain the Primary Root Growth? Prim...

Explain the Primary Root Growth? Primary Growth in Roots :  Roots grow down and through the soil by adding new cells at the tip of the root (called the root tip). There is a

In what ways is genomic imprinting similar to x-inactivation, Based on the ...

Based on the simplified two-gene model for eye colour, explain using genotypes how two blue-eyed parents could produce a brown-eyed child. In what ways is genomic imprinting sim

Can you explain about thoracic aortography, Q. Can you explain about thorac...

Q. Can you explain about thoracic Aortography? Aortic arch angiography has been used to assess aortic valve or aortic root disease. Thoracic aortography is helpful for assessm

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd