Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
• Cyclins accumulate during the G1, S, and G2 phases of the cell cycle. • By the G2 checkpoint (the red bar in the figure), enough Cyclin is available to form MPF complexes (aggregations of Cdk and Cyclin) which initiate mitosis.
o MPF apparently functions by phosphorylating key proteins in the mitotic sequence.
• Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of Cyclin
o Cdk, the non-Cyclin part of MPF, persists in the cell as an inactive form until it associates with new Cyclin molecules synthesized during Interphase of the next round of the cell cycle.
The major hazards encountered in the biological lab work are diseases like infections and allergies which are caused by handling live animals. dissections, plant and animal tissues
the characteristics of flying fish belong to pisces
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
HEARIN G - Sound waves struck ear drum, it starts vibrations, these vibrations are carried to MIS → f. ovalis → S. vestibule → Hellicotrema → S. Tympani → f. rotundus → mi
Unsaturated fatty acids show different types of isomerisms. We have already learnt about the.concept of isomerism in the last unit. You would realize that fatty acids with s
What are the common changes in the eye Other changes in the eye are: 1) Increase in curvature of anterior surface of lens. 2) Anterior pole of lens moves forwards without
Q. Function of Glutamate? Glutamate It is the principal excitatory transmitter in the brain and is found throughout the central nervous system. Receptors Glutamate rec
meaning of the law of inertia
Suppose you treated butter with a fatty acid desaturase, an enzyme that removes hydrogen from fatty acids and creates double bonds. Please explain what would happen?
what is the origin, uses, morphology, active constituents and market perparations ?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd