Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
• Cyclins accumulate during the G1, S, and G2 phases of the cell cycle. • By the G2 checkpoint (the red bar in the figure), enough Cyclin is available to form MPF complexes (aggregations of Cdk and Cyclin) which initiate mitosis.
o MPF apparently functions by phosphorylating key proteins in the mitotic sequence.
• Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of Cyclin
o Cdk, the non-Cyclin part of MPF, persists in the cell as an inactive form until it associates with new Cyclin molecules synthesized during Interphase of the next round of the cell cycle.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Where does cartilage occur in a joint and what is its function ?
Define seliwanoff's Test or Resorcinol Hydrochloric Acid Reaction? seliwanoff's test is specific test for ketonic groups and therefore is positive for ketose sugars like fruc
Define Exclusion chromatography - basic separation technique? It is a chromatographic process, in which separation of the sample components takes place according to the molecul
Based on your reading of the article "Hello Mothers, Hello Father" which of the following is a correct statement regarding the transplantation of mitochondria? A. The sperm cel
Explain the Deficiency and Toxicity of vitamin A? Who defines VAD as tissue concentrations of vitamin A low enough to have adverse health consequences even if there is no evide
Define Safety points that should used in the Laboratory? You should be aware of the rules/regulations and the procedures before undertaking any practical work in the laboratory
E n z y m e - linked immunosorbent assay (ELISA): ELISA in its var io us modifications e.g. plate ELISA, sandwich ELISA, competitive ELISA, ELISA strip or
Terminology use in Apical Dominance Here are a few terms that will be used in discussing apical dominance. A clear understanding of these terms is needed for understanding the
what are protein? What is the constituential uni. Of protein? Briefly explain the various forms of protein?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd