Mammalian testis, Biology

Assignment Help:

Mammalian Testis

You are aware that gonads of the male are called testis. In man and other mammals testes are lodged in an integumentary pouch called the scrotum. It is an adaptation for regulating the internal temperature of the testis. Whereas in non-mammalian vertebrates testes are present inside the body cavity, the peritonium. Mammalian testis is made of a series of elongated follicles or seminiferous tubules. The lining of the tubules constitutes an epithelium from which the spermatozoa are proliferated.

376_Testis.png

Figure: Mammalian Testis

The interspaces between the seminiferous tubules are occupied by blood vessels, connective tissues, and the interstitial cells of Leydig. Seminiferous tubule is limited by a thin basement membrane, in an adult testis often all stages of spermatogenesis are found at any level in cross-section of the tubule.


Related Discussions:- Mammalian testis

Is osmolarity of the interstitial fluid increase or decrease, If the osmola...

If the osmolarity of plasma (inside a capillary) is 300 mOsM, the osmolarity of the tissue fluid (interstial fluid) is 400, and the membranes are permeable to water but not to salt

Branches of Biology, Is pathology a subspecialty of zoology or botany?

Is pathology a subspecialty of zoology or botany?

Explain vulvovaginal candidiasis, Vulvovaginal candidiasis  Vulvovagina...

Vulvovaginal candidiasis  Vulvovaginal candidiasis is not sexually transmitted, but is often found incidentally in women with STIs. Many remedies are available for vulvovaginal

Describe atg or aug, ATG or AUG: The codon for the methionine; the transla...

ATG or AUG: The codon for the methionine; the translation initiation codon. generally, protein translation can only start at the methionine codon (although this codon might be fou

Criteria for identifying biodiversity hot spots, A simple method used to id...

A simple method used to identify areas of high conservation priority is the selection of countries according to highest species richness. Among the top 12 countries identified this

Malthus theory of human population growth, MA L THU S THEORY OF HUMAN PO...

MA L THU S THEORY OF HUMAN POPULATION GROWTH - Malthus put forward in 1778. 1.       Population grows in geometrical ratio, where as the means grow in arithmetical ratio.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What happens during aerobic respiration to the pyruvic acid, What happens d...

What happens during aerobic respiration to the pyruvic acid molecules made by glycolysis? What is the sequence of reactions that then follows? The pyruvic acid molecules made i

What is self-jamming, What is Self-jamming Unless all of the mobile cli...

What is Self-jamming Unless all of the mobile client are perfectly synchronized, the arriving transmissions from multiple clients will not be perfectly aligned on chip boundari

How are triglycerides made, How are triglycerides made? Triglycerides, ...

How are triglycerides made? Triglycerides, fats or oils, are made of three molecules of fatty acids bound to single molecule of glycerol. Hydroxyls of each one of the three fat

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd