Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Mammalian Heart
The division of heart and separation of systemic and pulmonary circulation is complete in birds and mammals. The structure of mammalian heart and also how the volume of fluid pumped by the heart is adjusted according to the oxygen needs of the body.
Figure: Mammalian Heart
The mammalian heart is a muscular organ covered by a tough fibrous sheath the pericardium. It consists of four chambers. Each half consists of a thin walled atrium and a thick walled ventricle. There are two sets of valves. Atrioventricular valve separates the cavities of the atrium and ventricle and prevents backflow of blood. Semilunar valves are present where the pulmonary artery leaves the right ventricle and the aorta leaves the left ventricle, preventing backflow. The contraction of heart is called systole and the relaxation, diastole. A heartbeat consists of a rhythmic contraction and relaxation of the whole muscle mass. The heart rests only during the short interval between contractions.
Define Isotope Dilution Method? The measurement of total body water (TBW) is based on the principle of hydrometry. You must be aware that water is the most abundant substance i
What is retrograde peri-implantitis? Retrograde peri-implantitis has been described by Misch as implant failure probably due to bone microfractures caused by premature implant
Regarding the article "One Hundred Tests" which of the following is a false statement? A. Genetic tests like the one developed by Counsyl can examine the multilevel genetic net
What are the main types of waste? The waste can be classified into main types, each of them carrying its own dissimilar environmental problem: organic waste, non recyclable was
Gametophytic Incompatibility In GSI systems callose deposition is not evident on the stigma but is very conspicuous in the pollen tube. Sometimes the callose deposition occurs
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How are the transparency and functions of cornea evaluated? Physiological roles of barrier function, refractive function (with interaction of tear film), response to wound and
What is Resection and Primary End to End Anastomosis ? For neonates and infants the best operation is resection of coarctation and primary end-to-end anastomosis. With the baby
Define influence of polyphenols on Carbohydrates? Binding of proteins may indirectly affect carbohydrate absorption. Inhibition of amylolytic enzymes and subsequent reduction o
Describe the Features common in ventricular outflow obstruction ? An ejection systolic murmur (ESM) due turbulent flow of blood through the obstruction. Hypertrophy of the cham
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd