Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Maedi/visna
Maedi, a progressive pneumonia, and visna, a neurotropic disease, found in sheep and goats are caused by the Maedi/visna virus, belonging to the family Retroviridae. It is a zoonotic disease. The disease has not been reported from India.Epidemiology: The transmission of disease takes place through inhalation, drinking contaminated water and colostrum by young ones. The intrauterine transmission of the virus has also been observed.
Clinical signs: Incubation period of over 2 years and has protracted clinical course lasting 6 months to several years.Maedi (progressive pneumonia): Progressive weight loss and dyspnoea, initially detected after exercise, and becomes more apparent over time. Affected sheep straggles, head jerking with inspiration and nostrils are flared. There may be nasal discharge and cough.
Visna: Weakness of the hindleg and stumbling. Progressive weight loss and trembling of facial muscels and limbs is seen leading to paraplegia.Diagnosis: The disease is diagnosed histopathology. Enzyme immunoassay, agar gel diffusion and syncytial plaque reduction assays are used for detection of antibodies. Western blotting is used for confirmation of the disease. Viral DNA is detected in cells by in situ hybridization or viral RNA amplification by RT-PCR.
Prevention and control: Slaughtering of sero-positive sheep is one of the approaches suggested for containing the infection. Dipping of sheep with acaricides and spraying in environment controls ticks.
Explain Acyclovir Available in topical, oral, and intravenous (IV) formulations, acyclovir is used to treat herpes simplex virus (HSV) and varicella-zoster virus (VZV) infectio
Emulsifying properties of proteins Proteins are the surface-active substances, which are extensively used in the food industry as emulsifiers to manufacture products such as d
What is commensalism? Commensalism is the ecological interaction in which one individual advantage while the other is neither benefited nor harmed. Commensalism is a harmonious
Define Complete Assessment for Dietary Management during Surgery? A complete assessment must include: Physical examination (anthropornetric measurements such as ideal/us
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Ascending Aortic Aneurysm ? Ascending Aortic Aneurysm : In aneurysms confined to ascending aorta well below the innominate artery origin, the technique used is
Define Nervous System and the it's related disorders? In this unit, we learnt about nervous system and the related disorders, which are termed as 'neurological disorders'. Neur
In at least single eukaryote, Tetrahymena, the pre-rRNA molecule holds an intron. Erasing of the intron in running processing of the pre-rRNA does not require the assi
Explain the Recommended Dietary Allowances - Nutrition? The recommended dietary allowances are defined as the 'daily dietary intake level that is sufficient to meet the nutrien
Explain the Kidney Function in human biology? Blood first enters the capillaries in Bowman's capsule where it is filtered. The pores in the capillary walls allow water and smal
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd