Lungs - respiration, Biology

Assignment Help:

Lungs - Respiration

Lungs can be simple, characterised by air exchange with surrounding environment by diffusion only. These are called the diffusion lungs and are present in small animals such as pulmonate snails, small scorpions, sane spiders and some isopods. The other type - ventilation lungs are typical of vertebrates.

2440_Lungs - Respiration.png

Figure: Breathing Cycle in Frogs

The air passes through a tube into inflatable lungs where gas exchange takes place and oxygen poor, carbon dioxide rich air is then forced out usually through the same tube. This is known as tidal flow of air. Ventilation of the lungs can take place in two different ways:

1) By using a pressure pump as in amphibians. Figure shows the process of ventilation in frog. The inflation of lungs depends on positive pressure bucco pharengeal pump. The nares remain open while glottis is closed (the air does not enters the lungs). The floor of the buccal cavity is raised and lowered periodically. At irregular intervals the glottis is open and nares are closed. The floor of the buccal cavity is raised forcing air into the lungs. As a result the frog can take in air several times without exhaling and blow itself up to considerable size. The glottis can close and while the air remains inside the lungs the cycle is replated in the buccal cavity.

2) By using a suction pump. Exhalation can be passive and inhalation is aided by muscle contraction or as in mammals, by contraction of muscular dome shaped diaphragm and external intercostal muscles lifting the ribcage. This decreases the pressure in the pleural space so causing the lungs to expand and air flows in.

 


Related Discussions:- Lungs - respiration

Strain of fusarium moniliforme, Q. Strain of Fusarium moniliforme? It w...

Q. Strain of Fusarium moniliforme? It was first obtained from a strain of Fusarium moniliforme isolated from southern leaf blight- damaged corn seed as a water soluble toxin.

Which chamber does the blood go after leaving left atrium, Q. To which hear...

Q. To which heart chamber does the blood go after leaving the left atrium? What is the valve that separates these compartments? The valve between the left atrium and the left v

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Radial cleavage - metazoa, Radial cleavage - Metazoa Radial cleavage p...

Radial cleavage - Metazoa Radial cleavage produces tiers or layers of cells one on top of another. Radial cleavage is also said to be indeterminate or regulative because each

Define physiology cohesion and adhesion theory, Define Physiology: Cohesion...

Define Physiology: Cohesion & Adhesion Theory? Transport in Plants :  Transport of water, minerals and nutrients within vascular plants is dramatically different from animals

Typical conformation of the age pyramids, Q. What is the typical conformati...

Q. What is the typical conformation of the age pyramids of underdeveloped countries? The age pyramids of the peripheral countries or the underdeveloped countries have character

What are the tissues that form the skin in vertebrates, Q. What are the tis...

Q. What are the tissues that form the skin in vertebrates? The skin of vertebrates is made of epidermis is an external layer of epithelial tissue and dermis a layer of connecti

Name the hormones produced by the testes, Name the hormones produced by ...

Name the hormones produced by (a) the testes, (b) the ovaries.   (a) The testes produce testosterone. (b) The ovaries produce oestrogen and progesterone.

Explain dietary management, Dietary Management The golden  rule  in  th...

Dietary Management The golden  rule  in  the dietary  management  of  ally  fever  is  "feed  the fever". Considering that  enteric (typhoid) fever  is accompanied by anorexia,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd