Lung abscess, Biology

Assignment Help:

Lung Abscess:

Lung  abscess  is a localised collection of pus in  the pulmonary parenchyma as a result of  suppuration and necrosis. The obstruction  of the bronchus of the involved  area is usually the preceding  event. Pulmonary  abscess may be multiple  or solitary. Solitary abscesses are encountered in tuberculosis,  pneumococcal or staphylococcal pneumonia and infected  congenitalcysts. It could occur  following  aspiration of foreign body or aspiration during operation of nasopharynx  and occasionally  following mpture of amoebic liver abscess  into lung or superadded infection of hydatid  cyst. Multiple abscess are encountered in Klebseilla  or staphylococcal  pneumonia with bronchiectasis,  following septicemia  in patient with hydrocephalus and in patients with agamma-globinaemia. The abscess may rupture into pleural space leading  to pyopneumothorax.  If the abscess is situated in the peripheral part, it may result in pleurisy  or  if it ruptures in pleura it may cause, empyema or pyopneumothorax. 

Nursing Assessment:

Child may present with fever, anorexia, pallor, lethargy, cough with foul smelling expectoration, chest pain, dyspnoea and haemoptysis. 

Diagnostic  evaluation include X-ray chest which shows cavity with or without  fluid surrounded by area of consolidation.  


Related Discussions:- Lung abscess

Explain uses of modified starches in food, Uses of modified starches in foo...

Uses of modified starches in food and confectionery industries Visit a grocery shop and look out for products such as the instant desserts, jelly beans, salad dressings, tomato

Class turbellaria, plz answer me how I arrange my topic with its order ?

plz answer me how I arrange my topic with its order ?

Skeletal system - cerebro-spinal fluid, Cerebro-spinal Fluid - Formed m...

Cerebro-spinal Fluid - Formed mainly by choroid plexus and ependyma of ventricles. It comes out of medulla oblongeta by foramen of magandie and lushka . Slightly alkalin

Protozoa., what is .groups of protozoa?

what is .groups of protozoa?

Sympatric speciation, Sympatric speciation can be regarded as speciation wh...

Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory.

#monocot and diocot seeds., can I know the difference between diocot and mo...

can I know the difference between diocot and monocot seeds in a plant

Define regulation of water balance, Define Regulation of Water Balance? ...

Define Regulation of Water Balance? The input of water, as well as, its loss can be highly variable due to individual habits and environmental factors; in spite of this, the to

Food texture and gas formers, Q. Food texture and Gas formers? Food tex...

Q. Food texture and Gas formers? Food texture: Recent studies indicate that strict omission of fibre is of no help on a peptic ulcer patient. The recurrence of peptic ulcer was

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do numeric pyramids represent?, What do numeric pyramids represent? ...

What do numeric pyramids represent? The Numeric pyramids represent the number of individuals in each trophic level of a food chain.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd