Lung abscess, Biology

Assignment Help:

Lung Abscess:

Lung  abscess  is a localised collection of pus in  the pulmonary parenchyma as a result of  suppuration and necrosis. The obstruction  of the bronchus of the involved  area is usually the preceding  event. Pulmonary  abscess may be multiple  or solitary. Solitary abscesses are encountered in tuberculosis,  pneumococcal or staphylococcal pneumonia and infected  congenitalcysts. It could occur  following  aspiration of foreign body or aspiration during operation of nasopharynx  and occasionally  following mpture of amoebic liver abscess  into lung or superadded infection of hydatid  cyst. Multiple abscess are encountered in Klebseilla  or staphylococcal  pneumonia with bronchiectasis,  following septicemia  in patient with hydrocephalus and in patients with agamma-globinaemia. The abscess may rupture into pleural space leading  to pyopneumothorax.  If the abscess is situated in the peripheral part, it may result in pleurisy  or  if it ruptures in pleura it may cause, empyema or pyopneumothorax. 

Nursing Assessment:

Child may present with fever, anorexia, pallor, lethargy, cough with foul smelling expectoration, chest pain, dyspnoea and haemoptysis. 

Diagnostic  evaluation include X-ray chest which shows cavity with or without  fluid surrounded by area of consolidation.  


Related Discussions:- Lung abscess

What are heterotrophic beings, What are autotrophic beings? What are hetero...

What are autotrophic beings? What are heterotrophic beings? Autotrophic beings are those that can make their own food, i.e., that make organic material from inorganic compound

Eggs, What is the type of egg in which yolk is absent?

What is the type of egg in which yolk is absent?

Chest and leg wound complications, Chest and Leg Wound Complications ...

Chest and Leg Wound Complications :  The patients under going CABG are usually elderly, obese and nearly a quater of them are diabetic. So sonic of them get superficial or d

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Acute complications of diabetes, Q. Show Acute Complications of Diabetes? ...

Q. Show Acute Complications of Diabetes? Acute complications of diabetes include: Hypoglycemia or low blood sugar: The most frequent cause of low blood sugar is poor timing

How can coacervates formed of phospholipids or polypeptides, How can coacer...

How can coacervates be formed of phospholipids or polypeptides? Phospholipids are amphipathic molecules, i.e., they present a polar portion and a nonpolar portion. In contact w

Meosis, briefly describe the eggs and follicles

briefly describe the eggs and follicles

Define determinants of food security - food utilization, Define Determinant...

Define Determinants of Food Security - Food Utilization? It is the proper biological use of food, requiring a diet providing sufficient energy and essential nutrients, potable

Population and sigmoid curve, Name two possible why the number of live bact...

Name two possible why the number of live bacteria cell have reached the stationary growth by 60hrs and start to die off after 12hrs?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd