Long-chain fatty acids, Biology

Assignment Help:

Fatty acid breakdown brings about the oxidation of long-chain fatty acids. The fatty acids are first transformed to their acyl CoA (coenzyme A) derivatives and then degraded by the successive removal of two-carbon units from the end of the fatty acid as acetyl CoA. The pathway makes FADH2   and NADH directly. The acetyl CoA generates can also enter the citric acid cycle and make further NADH and FADH2. The NADH and FADH2 are then oxidized by the respiratory electron transport chain to yield energy in the shape of ATP.

 


Related Discussions:- Long-chain fatty acids

What percentage should be homozygous, If 40% gene pool is heterozygous then...

If 40% gene pool is heterozygous then what percentage should be homozygous?

Use of sulphur dioxide and sulphites in microorganisms, Q. Use of Sulphur d...

Q. Use of Sulphur dioxide and sulphites in microorganisms? Sulphur dioxide as a preservative in wine preparation has been in use since ancient times. It is also used in other f

Explain about the functional properties of proteins, Explain about the Func...

Explain about the Functional Properties of Proteins? It may be clear by now that functionality (as implied to food ingredients) refers to 'any property aside from the nutrition

What is the gross primary production of an ecosystem, Q. What is the gross ...

Q. What is the gross primary production of an ecosystem? How does GPP relate to photosynthesis? The Gross primary production of a GPP or ecosystem is the quantity of organic ma

Amoebae - protozoan, Amoebae - Protozoan Amoebae may be naked or enclo...

Amoebae - Protozoan Amoebae may be naked or enclosed in tests or shells. The marine, freshwater and parasitic naked amoebae have large commonly tubular lobopodia or fine strap

Why theories are import, Theories are import because they can be used to a....

Theories are import because they can be used to a. Test research hypothesis b. Develop questions which will facilitate more effective research c. Conduct more meaningful and useful

Explain the flow phase of stress response, Explain the Flow Phase of Stress...

Explain the Flow Phase of Stress Response? This is a neuro-endocrine response to physiological stress following the ebb phase. This phase is characterized by: Normal or

Homeostasis , Homeostasis Homeostasis may be defined as the maintenan...

Homeostasis Homeostasis may be defined as the maintenance of constancy in the internal environment of the organism. This is essential for maintenance of life. Without homeost

What are plasmids, What are plasmids? Plasmids are circular DNA molecul...

What are plasmids? Plasmids are circular DNA molecules there in the genetic material of some bacteria. They might be containing genes responsible for bacterial resistance to so

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd