Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Fatty acid breakdown brings about the oxidation of long-chain fatty acids. The fatty acids are first transformed to their acyl CoA (coenzyme A) derivatives and then degraded by the successive removal of two-carbon units from the end of the fatty acid as acetyl CoA. The pathway makes FADH2 and NADH directly. The acetyl CoA generates can also enter the citric acid cycle and make further NADH and FADH2. The NADH and FADH2 are then oxidized by the respiratory electron transport chain to yield energy in the shape of ATP.
If 40% gene pool is heterozygous then what percentage should be homozygous?
Q. Use of Sulphur dioxide and sulphites in microorganisms? Sulphur dioxide as a preservative in wine preparation has been in use since ancient times. It is also used in other f
Explain about the Functional Properties of Proteins? It may be clear by now that functionality (as implied to food ingredients) refers to 'any property aside from the nutrition
Q. What is the gross primary production of an ecosystem? How does GPP relate to photosynthesis? The Gross primary production of a GPP or ecosystem is the quantity of organic ma
Amoebae - Protozoan Amoebae may be naked or enclosed in tests or shells. The marine, freshwater and parasitic naked amoebae have large commonly tubular lobopodia or fine strap
Theories are import because they can be used to a. Test research hypothesis b. Develop questions which will facilitate more effective research c. Conduct more meaningful and useful
Explain the Flow Phase of Stress Response? This is a neuro-endocrine response to physiological stress following the ebb phase. This phase is characterized by: Normal or
Homeostasis Homeostasis may be defined as the maintenance of constancy in the internal environment of the organism. This is essential for maintenance of life. Without homeost
What are plasmids? Plasmids are circular DNA molecules there in the genetic material of some bacteria. They might be containing genes responsible for bacterial resistance to so
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd