Locomotion, Biology

Assignment Help:

Locomotion

All animals, simple or complex, are able of performing necessary bodily functions. One of these functions is Locomotion. Motility is one of the characteristics and basic attributes of all forms of life. It is a common property of protoplasm. Intracellular streaming movement of cytoplasm, Chromosome movement throughout cell division, special kinds of cell motility within the body of metazoans, like movement of intestinal villi, transport of substances in the axons, and ciliary beating in the respiratory tubes, etc. are all instances. Though, locomotion involves movement of the body like a whole from place to place. This is brought about in different animals in different ways and includes different structures in various animals. In this unit you will study the several types of locomotion exhibited and the structural components of the locomotory machinery between different non-chordate animals.


Related Discussions:- Locomotion

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the kind of nitrogen waste that mammals eliminate, Q What is the ki...

Q What is the kind of nitrogen waste that mammals eliminate? Like chondrichtian fishes and adult amphibians, mammals are ureotelic that is they excrete urea. Q. How do plac

Why rna was the first genetic material, Why does scientist think that RNA w...

Why does scientist think that RNA was the first genetic material?

Evolution, how to calculate the frequency of mating with the HW equation?

how to calculate the frequency of mating with the HW equation?

Deforestation - degradation of ecosystem, Deforestation - Degradation of Ec...

Deforestation - Degradation of Ecosystem The deforestation is a broad term. It means the removal/destruction of the forest cover or the vegetation of an area. It includes repe

What is palliative outflow patch, What is Palliative Outflow Patch ? Br...

What is Palliative Outflow Patch ? Brock described closed pulmonary valvotomy and infundibular resection using a punch on a beating heart. When both pulmonary arteries are not

Determine the factors that affecting food choice, Determine the Factors tha...

Determine the Factors that Affecting Food Choice? As a dietician, it is necessary to understand how our food choices are affected. Every day we make food choices which influenc

Explain glucose molecule runs the krebs cycle twice, Why can it be said tha...

Why can it be said that each glucose molecule runs the Krebs cycle twice? Every glucose molecule "cycles" the Krebs cycle twice because after glycolysis each used glucose has g

How does refrigeration help to stop food from going bad, How does refrigera...

How does refrigeration help to stop food from going bad?   Western diets are often unhealthy due to they have too much sugar and fat, and not sufficient fibre.

Facilitation model - models of succession, Facilitation Model - Models of S...

Facilitation Model - Models of Succession This is considered as the classical model of succession. It is based on the assumption that species of a previous stage are replaced

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd