Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
LIVING MATTER
Since at the subatomic level, all matter is basically similar, the fundamental chemical and physical principles are equally applicable to all objects in nature; yes two distinct types of objects are discernible everywhere the living and nonliving objects, The matter of the living objects organisms is a special type of greyish, semitransparent and viscous fluid, named protoplasm by Purkinje 1840 and later by Hugo von Mohl (1861).
Chemically, the Protoplasm is so highly organized matter that it is capable of converting chemical energy into Energy of Life or Biological Energy That is why Max Schultze 1861 called it the "Physical Basis of Life".
Q. What are the major negative ions found in living beings? The main anions found in living beings are the chlorine anion (Cl - ), the sulphate anion (SO - ), the nitrate ani
Explain Temperate Deciduous Forests-Taiga and tundra? Temperate deciduous forests are typified by the type of forests predominantly found in the eastern and northeastern Unit
Iron Deficiency Anaemia This is the most common nutritional and haematologic disorder in infancy and chhildhood in developing countries. It is caused by lack of sufficient i
PEPTID E BOND Peptide or amide bond is a linkage established condensation reaction between amino group of one amino acid and carboxylic group of the second amino acid.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Draw decanol, plamitic acid (C16:0 fatty acid) and the resulting wax ester generated by a dehydration reaction between both molecules.
What is an example of an ion of biological importance? Sodium in one, but so are potassium and calcium
Q. Can you explain about Garden and Green House? Public parks and gardens are centres of aesthetic beauty and serve as places of recreation. Botanic Garden is a living resposit
Listeriosis The organisms have an extensive host range which includes mammal, poultry, fish, crustaceans and ticks including man. The organism has been isolated from sheep, goats,
Discuss about electric field The electric field is a vector quantity whose magnitude is the force per unit charge and points in the direction of the force on the positive test
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd