Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
LIVING MATTER
Since at the subatomic level, all matter is basically similar, the fundamental chemical and physical principles are equally applicable to all objects in nature; yes two distinct types of objects are discernible everywhere the living and nonliving objects, The matter of the living objects organisms is a special type of greyish, semitransparent and viscous fluid, named protoplasm by Purkinje 1840 and later by Hugo von Mohl (1861).
Chemically, the Protoplasm is so highly organized matter that it is capable of converting chemical energy into Energy of Life or Biological Energy That is why Max Schultze 1861 called it the "Physical Basis of Life".
ALCOHOLISM - Continual heavy consuming of alcohol is called alcoholism or drinking . Word alcohol is refered to C 2 H 5 OH or ethyl alcohol or ethanol or grain alcohol.
significance of gastrulation
In the RBC, glucose can be oxidized to two primary products. One of the oxidation proucts is ribulose 5 phosphate, and the other is which of the following compounds? -lactate
What are seed gums? What are its characteristic properties? Seed gums are a group of polysaccharides with the following properties: light to dark cream colored amorphou
Define Evolution of food processing? 8000 - 7000 BC. Mankind first began farming, growing crops and raising animals for food instead of hunting and gathering for food.
Q. What are the environmental harms caused by mercury pollution? What are the main sources of mercury pollution? The Mercury is a metal that when present in the water of rivers
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the structure that maintains identical chromatids bound? The structure that maintains identical chromatids bound is the centromere. Cell Nucleus Review - Image Diver
Haptotaxis - Modes of Cell Movement Haptotaxis considers to the directed movement of cells in response to a concentration gradient of an adhesive molecule that might be presen
Define classification of carbohydrates - Polysaccharides? This classification is based on the number of monosaccharide units they contain, Polysaccharides are those polymers of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd