Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Littoral Zone
Plants of the littoral zone
Two types of plants occur here:
FOSSILIS A TIO N - The organisms are preserved and fossilized when they are buried in the ice, in an oil rich soil, in the lava of volcano, in swamps, in desiccated deser
Define Post-surgical Nutrition Support for CHD Patient? Nutrition support should be started as soon as possible. If oral not possible, enteral nutrition support should be pr
Insulin is released into the bloodstream by the β cells of the pancreas when blood glucose stages are high after feeding and stimulates glycogen synthesis to kept exces
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Slow creeping
Question 1 Write a short note on the following- Transfection Synthetic seeds Transgenic crops Agrometerology Question 2 Describe any 5 screening techniques use
Define Dietary and Non Dietary Factors - Causation of Cancer? Several dietary and non-dietary factors (including genetics) can increase the risk in the causation of cancer. Som
Q. What is competition? Which type of ecological interaction is competition? The Competition is the ecological interaction in which the individuals explore the similar ecologic
Define Nutritional Support Management for pancreatic cancer? When there is deficiency of exocrine pancreatic secretions, adequate amounts of pancreatic extract are helpful. It
Q. Fats requirements during congestive cardiac failure? Fat: The quantity and quality of fat would be governed by the severity of hyper- lipidemia and adiposity. Emphasis, as
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd