Littoral zone, Biology

Assignment Help:

Littoral Zone

Plants of the littoral zone

Two types of plants occur here:

  • Non-rooted phytoplanktons which include all kinds of algae occurring in the limnetic as well as those found only here. Certain species of green algae, blue green algae and diatoms remain attached to plant surfaces and are collectively called periphyton
  • All rooted or benthic flowering plants, attached to the substratum which occur in concentric zones within the littoral region. A general representative arrangement of rooted plants proceeding from the shallow towards the deeper lake area includes the following three sub-zones.

Related Discussions:- Littoral zone

Fossilisation, FOSSILIS A TIO N - The organisms are preserved and...

FOSSILIS A TIO N - The organisms are preserved and fossilized when they are buried in the ice, in an oil rich soil, in the lava of volcano, in swamps, in desiccated deser

Define post-surgical nutrition support for chd patient, Define Post-surgica...

Define Post-surgical Nutrition Support for CHD Patient? Nutrition support should be started as soon as possible. If oral not possible, enteral nutrition support should be pr

Hormonal control by insulin, Insulin  is  released  into  the  bloodstream ...

Insulin  is  released  into  the  bloodstream by  the  β  cells  of  the  pancreas  when blood glucose stages are high after feeding and stimulates glycogen synthesis to kept exces

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is transgenic animal, Question 1 Write a short note on the following- ...

Question 1 Write a short note on the following- Transfection Synthetic seeds Transgenic crops Agrometerology Question 2 Describe any 5 screening techniques use

Define dietary and non dietary factors - causation of cancer, Define Dietar...

Define Dietary and Non Dietary Factors - Causation of Cancer? Several dietary and non-dietary factors (including genetics) can increase the risk in the causation of cancer. Som

Which type of ecological interaction is competition, Q. What is competition...

Q. What is competition? Which type of ecological interaction is competition? The Competition is the ecological interaction in which the individuals explore the similar ecologic

Define nutritional support management for pancreatic cancer, Define Nutriti...

Define Nutritional Support Management for pancreatic cancer? When there is deficiency of exocrine pancreatic secretions, adequate amounts of pancreatic extract are helpful. It

Fats requirements during congestive cardiac failure, Q. Fats requirements d...

Q. Fats requirements during congestive cardiac failure? Fat: The quantity and quality of fat would be governed by the severity of hyper- lipidemia and adiposity. Emphasis, as

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd