List the different suturing techniques, Biology

Assignment Help:

List the different suturing techniques

There are a various suturing techniques each suited for a particular situation. Few of the common suturing techniques are:

i) Interrupted suture

- Simple Interrupted Stitch

- Figure of 8

ii) Mattress suture

- Vertical mattress

- Hori-ontal mattress

iii) Sling suture

- Single sling suture

- Continuous sling suture

 


Related Discussions:- List the different suturing techniques

Evaporative cooling, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain the determination of hydrolysis, Explain the Determination of Hydro...

Explain the Determination of Hydrolysis Hydrolysis of calcium pantothenate in acidic medium produces  α,γ-dihydroxy-β,β-dimethylbutyrolactone, which reacts with hydroxylamine i

ORGANIC MANUres, why manures are better than fertilizers

why manures are better than fertilizers

Classification scheme of protozoa, Classification Scheme of Protozoa ...

Classification Scheme of Protozoa Phylum Myxozoa Parasites of lower vertebrates especially fish and invertebrates. Phylum Microspora Parasites of inv

Ttt, respiration.

respiration.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Local control mechanism within the circulatory system, Which of the followi...

Which of the following is true for active hyperemia, a local control mechanism within the circulatory system? A. There will be an increase in force developed by smooth muscles

What are homologous chromosomes, What are homologous chromosomes? Which are...

What are homologous chromosomes? Which are the human cells that do not have homologous chromosomes? Chromosomes have genes (genetic information in the form of nucleotide sequen

Explain the alterations occurring in fish, Alterations occurring in fish ...

Alterations occurring in fish The skeletal muscle of fish consists of short fibers arranged between sheets of connective tissue. The connective tissue in the fish muscle is les

Science in the ancient world, Science in the ancient  world: We have e...

Science in the ancient  world: We have explained why we should study the history of science and what we mean by the history of science. We have seen what science is like in t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd