Light-environmental components, Biology

Assignment Help:

LIGHT

All of us know that the sun is the ultimate source of energy for all activities in our biosphere. The electromagnetic radiations from the sun supply energy which warms up the earth and the atmosphere to provide a favourable global temperature for the living organisms. In addition. light plays a variety of roles in the living world. It is essential for photosynthesis, the process by which light is converted into usable chemical energy. It is involved in the transmission of information, for instance, it helps plants and animals to programme their life cycles. coordinates the opening of buds and flowers, dropping of leaves and a variety of other physiological processes. Variation in theamount of light generally affects the local distribution of plants. In animals light regulates reproduction, hibernation and migration and of course makes vision possible. All these biological phenomena are readily influenced by variation in the intensity, and by seasonal or diurnal variations of light.


Related Discussions:- Light-environmental components

Zoonotic diseases, Zoonotic Diseases The term zoonosis (zoonoses, plura...

Zoonotic Diseases The term zoonosis (zoonoses, plural) was coined by Rudolf Virchow to describe the disease transmitted from animal to man and vice versa. Zoonoses have been de

1.notochord, general character and classification of platyhelminthes

general character and classification of platyhelminthes

Infectious canine hepatitis, Infectious canine hepatitis The disease i...

Infectious canine hepatitis The disease is caused by type-1 canine Adenovirus in the family Adenoviridae. The disease appears in pups as peracute, acute, and mild. The clinica

Cell cycle, What can stop a normal cell from growing?

What can stop a normal cell from growing?

Feeding on liquids, Feeding on Liquids Animals feeding on liquids are...

Feeding on Liquids Animals feeding on liquids are generally highly specialised for their feeding habits. Certain protozoa, endoparasites and aquatic invertebrates take up nut

What is the chemical equation of photosynthesis, What is the chemical equat...

What is the chemical equation of photosynthesis? The chemical equation of photosynthesis is the following: 6 CO 2 + 6 H 2 O + light --> C 6 H 12 O 6 + 6 O 2

Structure of the stomach, Describe the structure of the stomach. How is it ...

Describe the structure of the stomach. How is it modified to carry out its functions? How does it compare to that of the fetal pig?

How are lipids classified, Regarding solubility, how are lipids classified?...

Regarding solubility, how are lipids classified? Fats and oils are hydrophobic molecules, i.e., they are non polar and insoluble in water. Lipids in general are molecules with

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd