Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
LIGHTAll of us know that the sun is the ultimate source of energy for all activities in our biosphere. The electromagnetic radiations from the sun supply energy which warms up the earth and the atmosphere to provide a favourable global temperature for the living organisms. In addition. light plays a variety of roles in the living world. It is essential for photosynthesis, the process by which light is converted into usable chemical energy. It is involved in the transmission of information, for instance, it helps plants and animals to programme their life cycles. coordinates the opening of buds and flowers, dropping of leaves and a variety of other physiological processes. Variation in theamount of light generally affects the local distribution of plants. In animals light regulates reproduction, hibernation and migration and of course makes vision possible. All these biological phenomena are readily influenced by variation in the intensity, and by seasonal or diurnal variations of light.
Zoonotic Diseases The term zoonosis (zoonoses, plural) was coined by Rudolf Virchow to describe the disease transmitted from animal to man and vice versa. Zoonoses have been de
general character and classification of platyhelminthes
Infectious canine hepatitis The disease is caused by type-1 canine Adenovirus in the family Adenoviridae. The disease appears in pups as peracute, acute, and mild. The clinica
What can stop a normal cell from growing?
Feeding on Liquids Animals feeding on liquids are generally highly specialised for their feeding habits. Certain protozoa, endoparasites and aquatic invertebrates take up nut
What is the chemical equation of photosynthesis? The chemical equation of photosynthesis is the following: 6 CO 2 + 6 H 2 O + light --> C 6 H 12 O 6 + 6 O 2
Describe the structure of the stomach. How is it modified to carry out its functions? How does it compare to that of the fetal pig?
What structure does the sheath replace in a dicot?
Regarding solubility, how are lipids classified? Fats and oils are hydrophobic molecules, i.e., they are non polar and insoluble in water. Lipids in general are molecules with
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd