Life forms - qualitative characters, Biology

Assignment Help:

Life Forms - Qualitative Characters

The form and structure of terrestrial communities are determined by the nature of vegetation. Vegetation may be classified according to growth form. The plants may be tall or short, herbaceous or woody, evergreen or deciduous. We might speak of trees, shrubs, and herbs, and then further sub-divide these categories into needle-leaved evergreens, broad-leaved evergreens, broad-leaved deciduous, shrubs, ferns, grasses and so on and so forth.

A more useful system was proposed by a Danish botanist, Christen Raunkiaer in the year 1903. In this system, instead of considering plants' growth form, he classified plants by life form, the relation of their height above ground to their perennating organ. A perennating organ is one that survives from one growth season to the next, remaining inactive over winter or dry periods. Perennating tissue is the embryonic or meristematic tissue of buds, bulbs, tubers, roots and seeds.


Related Discussions:- Life forms - qualitative characters

Urine sugar testing, Testing for urine sugars is not recommended for either...

Testing for urine sugars is not recommended for either diagnosis or monitoring of patients with diabetes. This is because a urine sugar is not a reliable test. When no facilities a

Special situations of pulmonary embolism, Q. Special situations of Pulmonar...

Q. Special situations of Pulmonary Embolism? The CXR is often abnormal in pulmonary embolism. Atelectasis and other focal pulmonary parenchymal abnormalities are the most commo

Explain the air samplers - air sampling, Explain the Air Samplers - Air Sam...

Explain the Air Samplers - Air Sampling? Air Samplers, e.g., all glass impinger and the Andersen sieve samplers may be used. Volume of the air sampled is known. In all glass im

Doppler evaluation for constrictive pericarditis, Q. Doppler evaluation for...

Q. Doppler evaluation for constrictive pericarditis ? 2D Echocardiography and Doppler evaluation can provide valuable clues to the presence of constrictive pericarditis. M-Mo

Animals vs plants, Animals vs Plants Organisms are of two main types an...

Animals vs Plants Organisms are of two main types animals and plants, although all the above mentioned Unifying concepts of Biology apply equally to both animals and plants, ye

Describe shunts, Q. Describe Shunts? Detection, localization and quanti...

Q. Describe Shunts? Detection, localization and quantification of intracardiac shunts are one of the most important exercises in cardiac catheterization. In most cases a prelim

How can you convert 147.05mg%, How do you convert 147.05mg% of plasma gluco...

How do you convert 147.05mg% of plasma glucose to mM/L please show work.

Potential and excitation threshold for neurons, Q. How different are the co...

Q. How different are the concepts of action potential, resting potential and excitation threshold concerning neurons? Action potential is the maximum positive voltage level ach

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd