Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Life Forms - Qualitative Characters
The form and structure of terrestrial communities are determined by the nature of vegetation. Vegetation may be classified according to growth form. The plants may be tall or short, herbaceous or woody, evergreen or deciduous. We might speak of trees, shrubs, and herbs, and then further sub-divide these categories into needle-leaved evergreens, broad-leaved evergreens, broad-leaved deciduous, shrubs, ferns, grasses and so on and so forth.
A more useful system was proposed by a Danish botanist, Christen Raunkiaer in the year 1903. In this system, instead of considering plants' growth form, he classified plants by life form, the relation of their height above ground to their perennating organ. A perennating organ is one that survives from one growth season to the next, remaining inactive over winter or dry periods. Perennating tissue is the embryonic or meristematic tissue of buds, bulbs, tubers, roots and seeds.
Testing for urine sugars is not recommended for either diagnosis or monitoring of patients with diabetes. This is because a urine sugar is not a reliable test. When no facilities a
Q. Special situations of Pulmonary Embolism? The CXR is often abnormal in pulmonary embolism. Atelectasis and other focal pulmonary parenchymal abnormalities are the most commo
Explain the Air Samplers - Air Sampling? Air Samplers, e.g., all glass impinger and the Andersen sieve samplers may be used. Volume of the air sampled is known. In all glass im
Q. Doppler evaluation for constrictive pericarditis ? 2D Echocardiography and Doppler evaluation can provide valuable clues to the presence of constrictive pericarditis. M-Mo
Animals vs Plants Organisms are of two main types animals and plants, although all the above mentioned Unifying concepts of Biology apply equally to both animals and plants, ye
Q. Describe Shunts? Detection, localization and quantification of intracardiac shunts are one of the most important exercises in cardiac catheterization. In most cases a prelim
How do you convert 147.05mg% of plasma glucose to mM/L please show work.
Digestive system of human
Q. How different are the concepts of action potential, resting potential and excitation threshold concerning neurons? Action potential is the maximum positive voltage level ach
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd