Legal level -pollution control, Biology

Assignment Help:

Legal level -Pollution control

Pollution must be controlled by effective legislation also. Like USA, Japan, Germany and many other countries a comprehensive legislation for prevention and control of water pollution has also been enacted in India. The Water Act 1974 and Air Act in 1981 are being implemented through the Central Board and State Boards- the Central Board coordinates the regulatory norms and enacts strategies to be undertaken for effective prevention, control or abatement of water and air pollution in the country. It also looks after the pollution control activities in the Union Territories.

The Air Act is meant to regulate and control the emissions from automobiles and industrial plants. The state government can declare certain areas as "Air pollution control' areas" and the industries cannot operate in such areas without prior permission 'from the State Board: The Water Act prohibits the dumping of poisonous metals, hazardous chemicals and other pollutants into stream and wells. For dumping of sewage and industrial effluents in water, prior consent of the State Board is necessary.


Related Discussions:- Legal level -pollution control

Explain why the pigs in the f2 generation, If you create an F2 generation b...

If you create an F2 generation by mating two of the F1 offspring from your cross of a pure-bred brown pig with a pure-bred heavy spotted red pig. Explain why the pigs in your F2 ge

Describe organs of female reproductive system, Q. What are the organs that ...

Q. What are the organs that are part of the female reproductive system? The organs that constitute the female reproductive system are the ovaries, the uterus, the Fallopian tub

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you mean by advanced characters, What do you mean by Advanced chara...

What do you mean by Advanced characters The traits, or characteristics, that an animal has that are not ancestral to the taxon. They appear later in the evolutionary history of

Thermal fluctuations and bonds, The stabilization energy of a bond or inter...

The stabilization energy of a bond or interatomic interaction is the change in energy upon breakage of a bond between two atoms (i.e., the change in energy when the atoms are moved

What parameter can be calculate, In a twin study of 1000 MZ pairs, 625 pair...

In a twin study of 1000 MZ pairs, 625 pairs were found to have both twins with the same form of a given trait. In a study of 1000 DZ twins, 426 pairs were found to have both twins

Estrus - estrous cycle, Estrus - Estrous cycle This is the period of h...

Estrus - Estrous cycle This is the period of heat, and copulation is permitted only at this time. This condition lasts from 9 to 15 hours and is characterised by a high rate o

Poultry and duck diseases-avian reovirus infections, Avian reovirus infecti...

Avian reovirus infections There are several avian reoviuses isolated from chicken, turkey and other species of birds. They are associated with arthritis (tenosynovitis), respir

Conditions associated with increased need for vitamin a, Define Conditions ...

Define Conditions associated with increased need for Vitamin A? Conditions and populations associated with increased need for vitamin A includes young children  particularly  t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd