Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Routine blood tests like haemoglobin, creatinine, electrolytes are useful to plan treatment. More recently the blood natriuretic peptide levels have been used to assess heart failure. BNP (brain natriuretic peptide) may be increased early in left ventricular dysfunction. It is synthesized mainly by the ventricles and released early in heart failure.
The Framingham study group has come out with criteria for diagnosis of heart failure incorporating symptoms, signs, investigations and response to treatment. It is a useful criteria for the clinicians.
Major Criteria
Paroxysmal nocturnal dyspnoea Neck vein distention Rales Radiographic cardiomegaly Acute pulmonary edema S3 gallop Central venous pressure >16 cm H2O Circulation time >25 sec Hepatojugular reflux Pulmonary adema, visceral congestion, or cardiomegaly at autopsy Weight loss >4.5 kg in 5 days in response to treatment of congestive heart failure.
Minor Major
Bilateral ankle edema Nocturnal cough Dyspnoea on ordinary exertion Hepatomegaly Pleural effusion Decrease in vital capacity by one third from maximal value recorded Tachycardia (rate >120 beats/min)
Note: The diagnosis of congestive heart failure in this study required that two majoror one major and two minor criteria be present concurrently. Minor criteria were acceptable only if they could not be attributed to another medical condition.
In patients with left ventricular failure and reduced ejection fractions, the risk of LV thrombus formation and systemic arterial embolization appears to be primarily in patients
classification of excretory organs in helminthes, nermatodes, annelids, molluscs, arthropods and echinodems
Which are the organs that are part of the musculoskeletal system? The main organs and tissues that are part of the musculoskeletal system in humans are the cartilages, the bone
A few individuals from a herd of deer are forced to migrate to a new herd. This is an example of resulting in. a. Gene flow; enhance in similarities between populations.
what is gaseous exchange
Multiple Fission - Types of Asexual Reproduction Multiple fission is a variation of fission where the parent divides mitotically into a number of smaller units that are the da
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Discuss the following term in brief - Adaptive radiation Evolution of a variety of different species from a single common ancestor. Each is adapted for a particular niche, and
Q. What are the major events of the first mitotic period? The first mitotic period is the prophase. During prophase the following events occur migration of each centriole pair
What is autophagic intracellular digestion? Why is this type of intracellular digestion intensified in an organism undergoing starvation? Autophagic intracellular digestion is
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd