Laboratory tests - evaluation of heart failure, Biology

Assignment Help:

Routine blood tests like haemoglobin, creatinine, electrolytes are useful to plan treatment. More recently the blood natriuretic peptide levels have been used to assess heart failure. BNP (brain natriuretic peptide) may be increased early in left ventricular dysfunction. It is synthesized mainly by the ventricles and released early in heart failure.

The Framingham study group has come out with criteria for diagnosis of heart failure incorporating symptoms, signs, investigations and response to treatment. It is a useful criteria for the clinicians.

Major Criteria

 Paroxysmal nocturnal dyspnoea
 Neck vein distention
 Rales
 Radiographic cardiomegaly
 Acute pulmonary edema
 S3 gallop
 Central venous pressure >16 cm H2O
 Circulation time >25 sec
 Hepatojugular reflux
 Pulmonary adema, visceral congestion, or cardiomegaly at autopsy
 Weight loss >4.5 kg in 5 days in response to treatment of congestive heart failure.

 Minor Major

 Bilateral ankle edema
 Nocturnal cough
 Dyspnoea on ordinary exertion
 Hepatomegaly
 Pleural effusion
 Decrease in vital capacity by one third from maximal value recorded
 Tachycardia (rate >120 beats/min)

 Note: The diagnosis of congestive heart failure in this study required that two majoror one major and two minor criteria be present concurrently. Minor criteria were acceptable only if they could not be attributed to another medical condition.


Related Discussions:- Laboratory tests - evaluation of heart failure

Anticoagulation, In patients with left ventricular failure and reduced ejec...

In patients with left ventricular failure and reduced ejection fractions, the risk of LV thrombus formation and systemic arterial embolization appears to be primarily in patients

Excretory organs, classification of excretory organs in helminthes, nermato...

classification of excretory organs in helminthes, nermatodes, annelids, molluscs, arthropods and echinodems

What are the part of the musculoskeletal system, Which are the organs that ...

Which are the organs that are part of the musculoskeletal system? The main organs and tissues that are part of the musculoskeletal system in humans are the cartilages, the bone

What is sympatric isolation, A few individuals from a herd of deer are forc...

A few individuals from a herd of deer are forced to migrate to a new herd. This is an example of  resulting in.   a.  Gene flow; enhance in similarities between populations.

Multiple fission - types of asexual reproduction, Multiple Fission - Types ...

Multiple Fission - Types of Asexual Reproduction Multiple fission is a variation of fission where the parent divides mitotically into a number of smaller units that are the da

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Discuss the following term in brief - adaptive radiation, Discuss the follo...

Discuss the following term in brief - Adaptive  radiation Evolution of a variety of different species from a single common ancestor. Each is adapted for a particular niche, and

Describe first mitotic period, Q. What are the major events of the first mi...

Q. What are the major events of the first mitotic period? The first mitotic period is the prophase. During prophase the following events occur migration of each centriole pair

What is autophagic intracellular digestion, What is autophagic intracellula...

What is autophagic intracellular digestion? Why is this type of intracellular digestion intensified in an organism undergoing starvation? Autophagic intracellular digestion is

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd