Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Juxtaglomerular Apparatus
The autoregulation of renal blood flow involves a neuroendocrine mechanism related to the juxtaglomerular apparatus in the kidney.
Figure: Structure of the juxtaglomerular apparatus in mammals
When the afferent arterial blood pressure is low, the stretch sensitive receptors of the arterioles initiate nerve impulses which induce the secretion of a proteolytic enzyme called renin by the juxtaglomerular cells into the blood. This enzyme causes the release of a decapeptide called angiotensin-I from a large globular plasma protein known as angiotensinogen. Another proteolytic enzyme from the plasma, the converting enzyme, removes two amino acids from angiotensin-I to form an octapeptide called angiotensin-II. Angiotensin-II is about 200 times more powerful than norepinephrine in its lasopressor activity. It increases the blood pressure by two mechanisms. Firstly, it acts on the smooth muscle of the arterioles and causes strong vasoconstriction. Secondly, it stimulates the secretion of aldosterone by the adrenal cortex. Aldosterone enhances the uptake of Na+ by the kidney tubules and hence causes a rise in the plasma Na+ level. This results in an increase in the extracellular fluid volume and consequently an elevation in blood pressure. Angiotensin-II is degraded by an enzyme called Angiotensinase, present in plasma.
Q. Colony collapse disorder in honey bees? Honey bees (Apis mellifera) are social insects and live in colonies in hives. Honey bees were introduced from Europe to the USA to po
Q. How do antibodies work to neutralize antigens? The immunoglobulins or antibodies act to facilitate the destruction of antigens: they attract phagocytic leukocytes, they dire
According to their functions how can nutrients are classified? One possible and utile functional classification for nutrients is the one that divides them into energetic, struc
Q. Describe Consciousness as the waking state? Consciousness as the waking state: consciousness is also referred to as the waking state as opposed for example to sleep. All
Leptontene: The chromosomes becomes visible, shorten and thick. The size of the nucleus increase. The homologous chromosomes start getting closer to each other. Z
Define Nutritional Requirements of Fats and Oils for Adults? A desirable amount of a linoleic acid to be consumed by a normal adult is 3 en% (ICMR, 1990). The invisible fat pre
what is respiration
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain about the Artificial Sweeteners? As a group, artificial sweeteners are classed as "non-nutritive". Thus, they provide sweet sensation to the tastebuds, with no increasi
what are phototrophs
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd