Juxtaglomerular apparatus, Biology

Assignment Help:

Juxtaglomerular Apparatus

The autoregulation of renal blood flow involves a neuroendocrine mechanism related to the juxtaglomerular apparatus in the kidney.

1896_Juxtaglomerular apparatus.png

 Figure: Structure of the juxtaglomerular apparatus in mammals

When the afferent arterial blood pressure is low, the stretch sensitive receptors of the arterioles initiate nerve impulses which induce the secretion of a proteolytic enzyme called renin by the juxtaglomerular cells into the blood. This enzyme causes the release of a decapeptide called angiotensin-I from a large globular plasma protein known as angiotensinogen. Another proteolytic enzyme from the plasma, the converting enzyme, removes two amino acids from angiotensin-I to form an octapeptide called angiotensin-II. Angiotensin-II is about 200 times more powerful than norepinephrine in its lasopressor activity. It increases the blood pressure by two mechanisms. Firstly, it acts on the smooth muscle of the arterioles and causes strong vasoconstriction. Secondly, it stimulates the secretion of aldosterone by the adrenal cortex. Aldosterone enhances the uptake of Na+ by the kidney tubules and hence causes a rise in the plasma Na+ level. This results in an increase in the extracellular fluid volume and consequently an elevation in blood pressure. Angiotensin-II is degraded by an enzyme called Angiotensinase, present in plasma.


Related Discussions:- Juxtaglomerular apparatus

Colony collapse disorder in honey bees, Q. Colony collapse disorder in hone...

Q. Colony collapse disorder in honey bees? Honey bees (Apis mellifera) are social insects and live in colonies in hives. Honey bees were introduced from Europe to the USA to po

How do antibodies work to neutralize antigens, Q. How do antibodies work to...

Q. How do antibodies work to neutralize antigens? The immunoglobulins or antibodies act to facilitate the destruction of antigens: they attract phagocytic leukocytes, they dire

How can nutrients are classified, According to their functions how can nutr...

According to their functions how can nutrients are classified? One possible and utile functional classification for nutrients is the one that divides them into energetic, struc

Describe consciousness as the waking state, Q. Describe Consciousness as th...

Q. Describe Consciousness as the waking state? Consciousness as the waking state: consciousness is also referred to as the waking state as opposed for example to sleep. All

Leptontene and zygotene, Leptontene: The chromosomes becomes visible,...

Leptontene: The chromosomes becomes visible, shorten and thick. The size of the nucleus increase. The homologous chromosomes start getting closer to each other. Z

Define nutritional requirements of fats and oils for adults, Define Nutriti...

Define Nutritional Requirements of Fats and Oils for Adults? A desirable amount of a linoleic acid to be consumed by a normal adult is 3 en% (ICMR, 1990). The invisible fat pre

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the artificial sweeteners, Explain about the Artificial Sweet...

Explain about the Artificial Sweeteners? As a group, artificial sweeteners are classed as "non-nutritive". Thus, they provide sweet sensation to the tastebuds, with no increasi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd