Jaundice (icterus), Biology

Assignment Help:

Jaundice (Icterus)

Jaundice is classified as pre-hepatic (hemolytic), hepatic and post-hepatic (obstructive) depending on origin of the problem, and is characterized by yellowish discolouration of visible mucous membrane, and tissues. The obstructive jaundice may occur due to extra-hepatic biliary obstruction, or due to intra-hepatic primary cholestasis. It is more intense in obstructive and hepatocellular damage than when it is caused by excess destruction of red blood cells (RBC). The yellow pigment, bilirubin deposits in the plasma and other tissues. Bilirubin concentration in plasma increases (hyperbilirubinemia), if the production exceeds the excretory capacity of the liver. Jaundice may occur with or without impairment of bile flow. In impairment of bile flow, bilirubin metabolite is absent in the faeces and jaundice is very severe.

Etiology: Haemolytic jaundice is caused by bacterial toxins, babesiosis and inorganic and organic poisons. Bacillary haemoglobinuria and leptospirosis are characterized by intravascular haemolysis. Acute haemolytic anaemia is also seen in calves following drinking of large quantity of cold water, or drinking immediately after exercise in animals. Diffuse diseases of liver cause degeneration of hepatic cells due to toxic conditions that are enlisted under hepatitis. Obstructions of bile ducts by biliary calculi or obstruction of common bile duct by nematodes or infestation with trematodes are common in animals. The mechanical stasis of biliary flow is caused by fibrosed tissue.

Diagnosis: Failure of liver to dispose off bile pigments in the circulation may result in retention jaundice. This may be due to excessive destruction of red blood cells (RBCs). Haemolytic or damaged parenchymal cells are not able to excrete normal quantity of bile pigments (toxic jaundice). In toxic jaundice there is retention of bile pigments but anaemia is absent. If signs of anaemia accompany jaundice, haemolytic origin should be suspected.

Presence of urinary bilirubin and absence of urobilirubin from the urine and faeces indicate obstructive jaundice of extrahepatic type. When bile appears in the urine, one can be definite that either liver disease is present or bile duct is obstructed.

Treatment: The line of treatment suggested for the animals suffering from hepatitis is of value for its treatment.


Related Discussions:- Jaundice (icterus)

Explain transport and utilization of vitamin a, Explain Transport and Utili...

Explain Transport and Utilization of Vitamin A? The efficacy of the intestines to facilitate absorption and utilization of retinoid s and carotenoids depends upon the cellular

Organic substances - abiotic components, Organic Substances - Abiotic Compo...

Organic Substances - Abiotic Components These include carbohydrates, proteins, lipids and their derivatives which are derived from the waste products of plants and animals or

Define abbe condenser of microscope, Define Abbe Condenser of Microscope? ...

Define Abbe Condenser of Microscope? It is present beneath the stage, as shown in Figure. It collects and focuses a cone of light on the slide. Its position can be adjusted ver

Who receive any future pandemic flu vaccine, Since the availability of flu ...

Since the availability of flu vaccine is limited, who should receive any future pandemic flu vaccine?

Parasitic diseases - fascioliasis, P a r a s i t i c Diseases ...

P a r a s i t i c Diseases F a s cioliasis It is a liverfluke infestation characterized by hepatic insufficiency, bile duct obstruction, and poor production per

Mass extinction, Mas s Extinction - Since beginning many species ev...

Mas s Extinction - Since beginning many species evolved and got extinct (in fact only 1 % is living). Sometimes it occured suddenly at large scale, (most recently dinosa

What is the main biological process, Q. What is the main biological process...

Q. What is the main biological process that consumes carbon dioxide? The major biological process that consumes carbon dioxide is photosynthesis.

Is protein collagen has a high proportion of glycine, The protein collagen ...

The protein collagen has a high proportion (20% or more) of A. asparagine and glutamine B. proline and hydroxyproline C. glycine D. both A and B E. both A and C F

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain holding method of pasteurization, Explain holding method of pasteur...

Explain holding method of pasteurization In the holding method of pasteurization (62 o C for 30 minutes) or the high-temperature short-time (HTST), 71 o C for 15 minutes method

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd