Is the epithelium vascularized, Biology

Assignment Help:

Q. Is the epithelium vascularized? How do oxygen and nutrients reach the epithelium? Why is this feature an important evolutionary acquisition?

Epithelia are not vascularized capillaries don't directly reach their cells the epithelium exchanges substances by diffusion with the connective tissue situated under it.

Since the epithelia are not vascularized minuscule scratches or skin injuries that happen all the time do not trigger bleeding and do not expose the blood to contamination from external agents this is an important protective strategy discovered by evolution.


Related Discussions:- Is the epithelium vascularized

What is fermentation, What is Fermentation ? Fermentation is a process ...

What is Fermentation ? Fermentation is a process used by anaerobic organisms and certain cells of aerobic organisms, such as muscle cells deprived of oxygen, to obtain addition

Haemorrhagic septicaemia, H a e m o r r ha g i c septicaemia ...

H a e m o r r ha g i c septicaemia It is also known as septicemic pasteurellosis or barbone and the disease is clinically characterized by high fever, excessive saliv

What is genetic engineering, What is genetic engineering? The Genetic e...

What is genetic engineering? The Genetic engineering is the use of genetic knowledge to artificially manipulate genes: It is one of the fields of biotechnology.

Objectives of dietary management of myocardial infarction, Q. Objectives of...

Q. Objectives of dietary management of myocardial infarction? The objectives of dietary management of myocardial infarction patients are as follows: - To provide rest to the

Classification, What is omnispective classification

What is omnispective classification

Hydra, hydra has what symmetry......radial or biradial????

hydra has what symmetry......radial or biradial????

Zoonoses disease-campylobacteriosis, Campylobacteriosis The genus Camp...

Campylobacteriosis The genus Campylobacter has been long associated with the cause of veterinary diseases under different names. It is only in the last 30 years that these org

Zoonoses disease-staphylococcosis, Staphylococcosis The disease is caused ...

Staphylococcosis The disease is caused by the ingestion of preformed toxin released by Staphylococcus aureus. Epidemiology: Staphylococci grow in meat, dairy and bakery prod

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd