Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Is the epithelium vascularized? How do oxygen and nutrients reach the epithelium? Why is this feature an important evolutionary acquisition?
Epithelia are not vascularized capillaries don't directly reach their cells the epithelium exchanges substances by diffusion with the connective tissue situated under it.
Since the epithelia are not vascularized minuscule scratches or skin injuries that happen all the time do not trigger bleeding and do not expose the blood to contamination from external agents this is an important protective strategy discovered by evolution.
defination
What is Fermentation ? Fermentation is a process used by anaerobic organisms and certain cells of aerobic organisms, such as muscle cells deprived of oxygen, to obtain addition
H a e m o r r ha g i c septicaemia It is also known as septicemic pasteurellosis or barbone and the disease is clinically characterized by high fever, excessive saliv
What is genetic engineering? The Genetic engineering is the use of genetic knowledge to artificially manipulate genes: It is one of the fields of biotechnology.
Q. Objectives of dietary management of myocardial infarction? The objectives of dietary management of myocardial infarction patients are as follows: - To provide rest to the
What is omnispective classification
hydra has what symmetry......radial or biradial????
Campylobacteriosis The genus Campylobacter has been long associated with the cause of veterinary diseases under different names. It is only in the last 30 years that these org
Staphylococcosis The disease is caused by the ingestion of preformed toxin released by Staphylococcus aureus. Epidemiology: Staphylococci grow in meat, dairy and bakery prod
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd