Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Parthenogenesis
The development of egg to form an animal without fertilization is called as parthnogenesis.
Parthenogenesis was discovered by Charles Bonnet in the egg of sea urchin.
The generation obtained as a result of parthenogeneis is called as parthenote.
In parthenote only female character express.
what is the pH inside the stomach?Why is there a need to keep that pH level? How is it maintained?
TYPES OF EGGS Different species of animal has different type of eggs. They are classified on the following basis - 1 . ON THE BASIS OF AMOUNT OF YOLK On the ba
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the major structures of chloroplasts? Chloroplasts are involved by two membrane layers the inner and the outer membranes. Inside the organelle the formative unit is
Which of the following is true for SA node cardiac muscle cells? A. An increase in the binding of norepinephrine to beta-adrenergic receptors in SA node cells will lead to an i
Q. What are the four major groups into which the study of the plants is divided? In Botany the plant kingdom is divided into pteridophytes, bryophytes, angiosperms and gymnospe
1. Describe how the hypothalamus regulates the secretion of anterior pituitary hormones and identify all of the individual hypothalamic regulatory factors. Describe how the hypotha
What are the near point and the far point of the vision? The near point is the closest distance among an object and the eye that makes possible the formed image to be focused,
Theodosius Dobzhansky and Boris Spassky demonstrated the working of normalising selectioion a behavioural trait in two populations of Drosophida pseudobscura. The two populatiors w
Name the high-energy complex generated during the conversion of succinyl CoA to succinate in the citric acid cycle GTP or ATP is the high-energy complex generated during th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd