Introduction to parthenogenesis, Biology

Assignment Help:

Parthenogenesis

The development of egg to form an animal without fertilization is called as parthnogenesis.

Parthenogenesis was discovered by Charles Bonnet in the egg of sea urchin.

The generation obtained as a result of parthenogeneis is called as parthenote.

In parthenote only female character express.


Related Discussions:- Introduction to parthenogenesis

Food and digestion, what is the pH inside the stomach?Why is there a need t...

what is the pH inside the stomach?Why is there a need to keep that pH level? How is it maintained?

Types of eggs, TYPES OF EGGS Different species of animal has different ...

TYPES OF EGGS Different species of animal has different type of eggs. They are classified on the following basis - 1 .         ON THE BASIS OF AMOUNT OF YOLK On the ba

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define major structures of chloroplasts, Q. What are the major structures o...

Q. What are the major structures of chloroplasts? Chloroplasts are involved by two membrane layers the inner and the outer membranes. Inside the organelle the formative unit is

Explain the sa node cardiac muscle cells, Which of the following is true fo...

Which of the following is true for SA node cardiac muscle cells? A. An increase in the binding of norepinephrine to beta-adrenergic receptors in SA node cells will lead to an i

Major groups into which the study of the plants is divided, Q. What are the...

Q. What are the four major groups into which the study of the plants is divided? In Botany the plant kingdom is divided into pteridophytes, bryophytes, angiosperms and gymnospe

Regulatory factors, 1. Describe how the hypothalamus regulates the secretio...

1. Describe how the hypothalamus regulates the secretion of anterior pituitary hormones and identify all of the individual hypothalamic regulatory factors. Describe how the hypotha

What are the near point and the far point of the vision, What are the near ...

What are the near point and the far point of the vision? The near point is the closest distance among an object and the eye that makes possible the formed image to be focused,

Experiments of dobzhansky and spassky, Theodosius Dobzhansky and Boris Spas...

Theodosius Dobzhansky and Boris Spassky demonstrated the working of normalising selectioion a behavioural trait in two populations of Drosophida pseudobscura. The two populatiors w

Coa to succinate in the citric acid cycle, Name the high-energy complex gen...

Name the high-energy complex generated during the conversion of succinyl CoA to succinate in the citric acid cycle GTP  or  ATP is  the high-energy  complex generated during th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd