Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Into which classes are mollusc divided? What are some representing beings of each class?
The phylum Mollusca is separated into five major classes: pelecypods, or bivalves (Pelecypoda, or Bivalvia), includes clams, oysters, mussels; gastropods (Gastropoda), snails, sea slugs; cephalopods (Cephalopoda), squids, octopuses; scaphopods (Scaphopoda), tooth shells; Polyplacophora, chitons. There are a some other mollusc classes.
Explain about the Connecting models and data? Perhaps the most dramatic change in quantitative environmental biology in recent years has been the burgeoning progress in the dir
Q. Which are the three hormones that participate in the regulation of the renal function? Antidiuretic hormone or ADH or vasopressin, atrial natriuretic factor (or ANF) and ald
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is endosperm haustorium
M a r e k ' s disease (MD) It is a lymphopoliferative disease of domestic chicken caused by a herpes virus. Of the known 3 serotypes of MDV, Serotype I includes all the o
What is peristomium. Describe? The segment behind the prostomium in annelids which contains the oral opening. This segment like the prostomium isn't a true segment and has no s
are viruses cellular organisms
Is nitrogen is important plant nutrients Nitrogen is an important plant nutrient which is assimilated by most of the plants as nitrate and ammonium ions. Organic matter is the
If you look up a world atlas you would notice that most of the earth's surface is covered by the waters of the oceans (about 71%). Beneath the water surface is a fascinating world
How are the organelles of a single cell like the organs of a multicellular organism? Name two features of eukaryotic cells that prokaryotic cells lack.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd