Into which classes are mollusc divided, Biology

Assignment Help:

Into which classes are mollusc divided? What are some representing beings of each class?

The phylum Mollusca is separated into five major classes: pelecypods, or bivalves (Pelecypoda, or Bivalvia), includes clams, oysters, mussels; gastropods (Gastropoda), snails, sea slugs; cephalopods (Cephalopoda), squids, octopuses; scaphopods (Scaphopoda), tooth shells; Polyplacophora, chitons. There are a some other mollusc classes.

Related Discussions:- Into which classes are mollusc divided

Explain about the connecting models and data, Explain about the Connecting ...

Explain about the Connecting models and data? Perhaps the most dramatic change in quantitative environmental biology in recent years has been the burgeoning progress in the dir

Regulation of the renal function, Q. Which are the three hormones that part...

Q. Which are the three hormones that participate in the regulation of the renal function? Antidiuretic hormone or ADH or vasopressin, atrial natriuretic factor (or ANF) and ald

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Endosperm haustorium, what is endosperm haustorium

what is endosperm haustorium

Marek''s disease (md), M a r e k ' s disease (MD) It is a lymphop...

M a r e k ' s disease (MD) It is a lymphopoliferative disease of domestic chicken caused by a herpes virus. Of the known 3 serotypes of MDV, Serotype I includes all the o

What is peristomium. describe, What is peristomium. Describe? The segme...

What is peristomium. Describe? The segment behind the prostomium in annelids which contains the oral opening. This segment like the prostomium isn't a true segment and has no s

Viruses, are viruses cellular organisms

are viruses cellular organisms

Is nitrogen is important plant nutrients, Is nitrogen is important plant nu...

Is nitrogen is important plant nutrients Nitrogen is an important plant nutrient which is assimilated by most of the plants as nitrate and ammonium ions. Organic matter is the

Aquatic biomes, If you look up a world atlas you would notice that most of ...

If you look up a world atlas you would notice that most of the earth's surface is covered by the waters of the oceans (about 71%). Beneath the water surface is a fascinating world

Name two features of eukaryotic cells, How are the organelles of a single c...

How are the organelles of a single cell like the organs of a multicellular organism? Name two features of eukaryotic cells that prokaryotic cells lack.

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages