Indian tick typhus, Biology

Assignment Help:

Indian tick typhus


Indian tick typhus (Mediterranean spotted fever) is a tick-borne rickettsial infection caused by Rickettsia conori and is characterized by fever and a characteristic rash. The principal mammalian reservoir of the organism is the dog.

Epidemiology: Tick typhus exists primarily as a zoonosis. The organisms are maintained in ticks and various species of small and large mammals. Most part of the infection is carried by the dog ticks, Rhipicephalus sanguineus. Dogs, many of which are latently infected, serve as a reservoir to the causative agents. Once ticks are infected, they remain so for their life cycle and the twin processes of transovarial and transstadial transmission help to maintain the cycle in nature. Man is only an accidental host and plays no role in the maintenance of the organism.Epidemics of tick typhus have not been reported in India, however, sporadic cases were reported from Punjab, Madhya Pradesh, Karnataka, Tamil Nadu, Maharashtra and Kerala.


Clinical features:
The incubation period is 3-4 days after the tick bites. There is an acute onset of fever and severe headache. The regional lymph nodes are enlarged. After the onset of fever, maculopapular rash develops on ankles and wrists and sometimes spread to the whole body. The clinical course is generally short with intermittent fever lasting up to 10-12 days. Mortality does not generally exceed 10 %.

Diagnosis: Presence of rickettsia in ticks can be demonstrated by haemolymph test. In this test, the distal portion of one of the legs of a tick is amputed, a drop of  haemolymph is collected on a clean glass slide and is stained with the Gimenez staining technique. Examination of the smear will reveal the presence or absence of the organism. This test is useful when a large number of ticks have to be screened, or when the patients bring the ticks detected on their body.Rickettsiae can be isolated from the acute phase blood by processing it in susceptible laboratory animal like guinea-pig. The animal develops pyrexia after 5-12 days.


Prevention and control:
It is a tick-borne disease and control of ticks should be undertaken. Insecticidal treatment of animal is a useful measure to free them from ticks. People should be educated about the danger of tick bites.


Related Discussions:- Indian tick typhus

Buffalo-pox, Buffalo-pox The disease is caused by an orthopox virus, c...

Buffalo-pox The disease is caused by an orthopox virus, closely related to the vaccinia virus. It is not clear whether it should be considered a separate virus or not. By RE m

Functions of skin, FUNCTIONS OF SKIN - Skin performs various diverse fu...

FUNCTIONS OF SKIN - Skin performs various diverse functions, that is why it is called "jack of all trades". 1 .      Protection - The skin protects the internal soft or

Determine the proecss of contrast sense, Contrast sense Sense of contr...

Contrast sense Sense of contrast is the ability to perceive slight changes in luminance between regions which are not separated by definite borders. This is as important as to

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The ideas of energy and chemical cycles, How do the ideas of energy and che...

How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?

Differance among subphylum chaetognatha and urochordata, Explain differance...

Explain differance between Subphylum Chaetognatha and Subphylum Urochordata? Subphylum Chaetognatha: Larval stages of this small group share some of the characteristics with

Energy storage, Energy Storage As we said above, food intake and ener...

Energy Storage As we said above, food intake and energy expenditure for animals is approximately equal. If energy expenditure exceeds food intake, then the excess energy is t

What is the importance of uterine glycogen-producing glands, What is the im...

What is the importance of the uterine glycogen-producing glands? The uterine glands produce glycogen that can be degraded into glucose to nourish the embryo before the complete

Explain disease jet lag, Jet Lag   Disturbance of body and environmental...

Jet Lag   Disturbance of body and environmental rhythms resulting from a rapid change in time zones gives rise to jet lag, which is characterized by insomnia, decreased quality

What are the major functions of the blood, Q What are the major functions o...

Q What are the major functions of the blood? The blood is a means of substance transportation throughout the body. The blood distributes hormones, nutrients, oxygen, cells and

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd