Indian tick typhus, Biology

Assignment Help:

Indian tick typhus


Indian tick typhus (Mediterranean spotted fever) is a tick-borne rickettsial infection caused by Rickettsia conori and is characterized by fever and a characteristic rash. The principal mammalian reservoir of the organism is the dog.

Epidemiology: Tick typhus exists primarily as a zoonosis. The organisms are maintained in ticks and various species of small and large mammals. Most part of the infection is carried by the dog ticks, Rhipicephalus sanguineus. Dogs, many of which are latently infected, serve as a reservoir to the causative agents. Once ticks are infected, they remain so for their life cycle and the twin processes of transovarial and transstadial transmission help to maintain the cycle in nature. Man is only an accidental host and plays no role in the maintenance of the organism.Epidemics of tick typhus have not been reported in India, however, sporadic cases were reported from Punjab, Madhya Pradesh, Karnataka, Tamil Nadu, Maharashtra and Kerala.


Clinical features:
The incubation period is 3-4 days after the tick bites. There is an acute onset of fever and severe headache. The regional lymph nodes are enlarged. After the onset of fever, maculopapular rash develops on ankles and wrists and sometimes spread to the whole body. The clinical course is generally short with intermittent fever lasting up to 10-12 days. Mortality does not generally exceed 10 %.

Diagnosis: Presence of rickettsia in ticks can be demonstrated by haemolymph test. In this test, the distal portion of one of the legs of a tick is amputed, a drop of  haemolymph is collected on a clean glass slide and is stained with the Gimenez staining technique. Examination of the smear will reveal the presence or absence of the organism. This test is useful when a large number of ticks have to be screened, or when the patients bring the ticks detected on their body.Rickettsiae can be isolated from the acute phase blood by processing it in susceptible laboratory animal like guinea-pig. The animal develops pyrexia after 5-12 days.


Prevention and control:
It is a tick-borne disease and control of ticks should be undertaken. Insecticidal treatment of animal is a useful measure to free them from ticks. People should be educated about the danger of tick bites.


Related Discussions:- Indian tick typhus

Explain fossn ovalis defect ostium secundum defect, Explain Fossn Ovalis De...

Explain Fossn Ovalis Defect (Ostium Secundum Defect) ? This is the most common type of atrial septal defect. The usual approach is through a midline incision and median sterno

Explain about the waist to hip ratio (whr), Explain about the Waist to Hip ...

Explain about the Waist to Hip Ratio (WHR)? Two individuals who have the same BMI and the same total body fat may have different abdominal fat mass. Abdominal fat accumulation

Describe the types of drugs, Describe the types of Drugs • Induction a...

Describe the types of Drugs • Induction agent (thiopentone, fentanyl, ketamine, midazolam) • Suxamethonium (1-2 mg/kg) is the muscle relaxant of choice. Rapid sequence ind

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Digestion of food materials, DIGESTION OF FOOD MATERIALS Digestion, you...

DIGESTION OF FOOD MATERIALS Digestion, you know, involves  the mixing of  food, its movement through the digestive tract and chemical breakdown of the large ntolecules of  food

Mycoplasmosis, Mycoplasmosis Mycoplasmas are the aetiological agents o...

Mycoplasmosis Mycoplasmas are the aetiological agents of bovine pleuropneumonia in cattle caused by Mycoplasma mycoides subsp. mycoides, caprine pleuropneumonia in goats cause

How are the beings of the phylum annelida classified, Q. Concerning the occ...

Q. Concerning the occurrence of separated sexes how are the beings of the phylum Annelida classified? These beings may be dioecious (the majority of polychaetes) or hermaphrodi

What is the treatment process of mitral stenosis, Q. What is the treatment ...

Q. What is the treatment process of mitral stenosis? Presence of symptoms or any complications is an indication for treatment. Apart from penicillin prophylaxis no other treatm

Sericulture, i want to know about sericulture for assignment degree level

i want to know about sericulture for assignment degree level

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd