Incomplete dominance (1:2:1), Biology

Assignment Help:

INCOMPLETE DOMINANCE (1:2:1)

Sometimes two genes of allelomorphic pair do not show dominant-recessive relationship, but when present simultaneously (or come together), they show intermediate condition or blend together, which is called incomplete dominance. It is due to the fact that the dominant character or gene is not in a position to completely suppress the recessive one. With the result, the heterozygote has a different phenotype (as well as different genotype) from homozygous for either allele.

  • First case of incomplete dominance was reported in Mirabilis jalapa (4 o'clock plant) by Carl Correns (1903).

Incomplete dominance is found in both plants and animals. Good examples are seen in Mirabilis jalapa, Antirrhinum majus, (snapdragon) and Andalusian fowl.

Example :- 1

In Mirabilis jalapa (4 o'clock plant) and Antirrhinum majus (Snapdragon or Dog flower) there are two types of flower colour in pure state, red and white.

A cross between a plant pure for red flowers and a plant pure for white flowers yield hybrid plants with pink flowers in F1 generation. Neither red nor white is completely dominant, so that both colour appear in the hybrids as a blend which is pink. This is obviously a contradiction of Mendel's assumption that no blending of characters takes place. When two of the hybrid plants with pink flowers are crossed, the F2 generation includes plants with red, pink and white flowers in the usual Mendelian ratio of 1 : 2 : 1.

1584_incomplete dominance.png

Incomplete dominance.

This cross shows :-

(i)         Incomplete dominance.

(ii)         The genes for red and white colour do not actually mix in the F pink hybrids as both the pure characters (red and white) reappear in the F1 plants.

(iii)        There is no specific gene for pink flowers.

(iv)        Quantitative effect of genes. The homozygous plants rr are unable to produce the flower pigment. The heterozygous plants Rr can produce only half the amount of flower pigment that is produced by the homozygous plant RR. In the F2 generation of the above cross :-

(i)         The genotypic ratio is the same as Mendelian ratio, being 1 : 2 : 1 (1 RR : 2 Rr : 1 rr).

(ii)         The phenotypic ratio differs from the Mendelian ratio, also being 1 : 2 : 1 (red : pink : white) instead of 3 : 1 (red : white).

(iii)        Half of the F2 generation show F1 phenotype instead of 3/4. 

The phenotypic Fratio of 1 : 2 : 1 is characteristics of incomplete dominance.

Example :- 2

Incomplete dominance is also found in Andalusian fowl. The Andalusian fowl is found in three colours : Black, white and blue. Pure forms are black (BB) and white (bb). If these two forms are crossed, F1 individuals appear blue (Bb) coloured. The blue hybrids on crossing with each other (Bb, Bb) give rise to one black (BB), two blue (Bb) and one white (bb) in 1 : 2 : 1 ratio. The blue appearance of the hybrids is due to very fine alternating white and black strips on the feathers.


Related Discussions:- Incomplete dominance (1:2:1)

Assignment, Economic and ecological importance of protozoans

Economic and ecological importance of protozoans

Concept of nursing unit, CONCEPT OF NURSING UNIT: Concept in the desig...

CONCEPT OF NURSING UNIT: Concept in the design and facilities of nursing unit has been changed time to time based on the different categories of patients and peculiarities of

What is cell cycle, What is cell cycle? Cell cycle, or mitotic cycle, i...

What is cell cycle? Cell cycle, or mitotic cycle, is the time period that starts when the cell is formed and finishes when it is divided by mitosis making two daughter cells. T

Determine the architecture of cell, Determine the architecture of cell ...

Determine the architecture of cell There are over 200 types of cells in the human body, which are assembled into a variety of tissues, such as, the epithelia, connective tissue

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Heat loss, Heat Loss Temperature regulation is extremely uneconomical...

Heat Loss Temperature regulation is extremely uneconomical if it depends only on variations in metabolism. Therefore, mechanisms for losing excess heat have been developed by

Issues impacting health and development -inefficiency, Normal 0 ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

What are the factors to measure such a prediction, You are interested in pl...

You are interested in plant life history evolution, you come across a population of the California poppy that i spolymorphic (mixed) for both iteroparous ans semeparous individuals

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd