Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Implantation - Pre-Embryonic Development
After entering the uterus and formation of ICM, the blastocyst starts to embed in the endometrium of the uterine wall. By one week after fertilization the trophoblast secretes enzymes which digest the tissues and blood vessels of the uterine wall. The invading trophoblast differentiates into two layers, the outer syncytiotrophoblast and the inner cellular layer. Like the syncytiotrophoblast swallows more blood vessels in the uterine wall lacunae develop in the syncytiotrophoblast that get filled up with blood from the mother and exchange of gases takes place here. So a primitive utero- placental circulation is established. This nourishes the embryo till the placenta is made. By the 10th day the blastocyst is totally embedded in the uterine wall.
This kind of implantation in which the embryo gets fully embedded is termed as interstitial implantation. The trophoblast begins to secrete human chorionic gonadotropin (HCG). HCG causes the corpus luteum to be maintained and to carry on to secrete estrogen and progesterone. Sometimes implantation may occur outside the uterus at some other location. In that case it is an ectopic pregnancy. The implantation site might be the fallopian tube or even the abdominal cavity. In ectopic pregnancy the embryo has to be surgically removed as if it is not done, it can lead to tuba1 rupture, internal bleeding, shock and possible death. At the beginning of the second week a small cavity appears between the trophoblast and ICM. This is the amniotic cavity that will grow around the embryo and later the foetus, It is a fluid filled cavity that act as an insulator against shocks, cold and heat. At similar time the ICM also differentiates into two layers, the upper epiblast which provides rise to the embryo and the lower hypoblast which gives rise to the extraembryonic membranes.
Determine about the visual axes of eyes In normal eyes, the visual axes are parallel to each other in the primary position of gaze. This position is usually maintained but in t
Define sex
Fishes- Regeneration in Vertebrates Several different parts of the fish body will re-grow. Plucked scales are promptly replaced by new ones and amputated gill filaments can re
Q. Living beings are made of inorganic and organic substances. According to the molecular complexity how can each of those substances be classified? Inorganic substances, mole
Determine Fat Soluble Vitamin Needs of school children and adolescents? ICMR (1990) does not give recommendations for vitamin D, E and K. Vitamin D is very important for skelet
The enzyme in the TCA cycle that catalyzes a substrate level phosphorylation is -citrate dehydrogenase -succinate thiokinase -isocitrate dehydrogenase
BUCCAL CAVITY - Situated between upper & lower jaw. It is lined by stratified squamous epithelium. Separated from nasal chamber by palate. Palate forms roof of buccal cav
What are synthetic auxins and what are their uses? Synthetic auxins, like indolebutyric acid (IBA) and naphthalenic acid (NAA) are substances same to IAA (a natural auxin) but
Q. Concerning events during the periods of life how different is the gametogenesis in men and in women? The formation of spermatogonia in men takes place during the embryonic p
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd