Implantation, Biology

Assignment Help:

 

Implantation : It is the process in which the blastocyst (developing zygote) is attached to the glandular uterine wall and then embedded in the wall of uterus.

1) In human beings fertilization occurs in the fallopian tube.

2) The sperm fuses with the ovum to form a zygote which is diploid.

3) It undergoes mitotic divisions and develops into a blastocyst.

4) By the contractions of the muscles of fallopian tube and the ciliary movements the blastocyst moves towards the uterine walls and gets attached to it.

5) This is called implantation. Further development of the embryo occurs in the uterus.

25_Implantation.png


Related Discussions:- Implantation

Chemical bonding, Chemical bonding : The present matter of earth contains ...

Chemical bonding : The present matter of earth contains atoms bound in groups of two or more called molecules. Their binding capacity is called chemical reactivity; It depends upo

Define nutritional requirements for young and older children, Define Nutrit...

Define Nutritional requirements for Young and Older Children? Young children need 3 en%, which would be easily met from 8-10 g of oil. However, more visible oil is needed to im

Terminal process of diseased stage, Terminal process of diseased stage ...

Terminal process of diseased stage This is the last stage in the process of disease. In this stage, the disease process is halted either temporarily or permanently. There are t

Human eye, Difference between rod and cone cells

Difference between rod and cone cells

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Ram ventilation, Ram Ventilation Some fish do not use pumping action f...

Ram Ventilation Some fish do not use pumping action for gill ventilation. It has been known for long that large tunas cannot be kept alive in captivity unless they are put in

Louping ill, Louping ill This is an infectious encephalomyelitis of sh...

Louping ill This is an infectious encephalomyelitis of sheep and man occurring during spring and summer when the vectors like ticks are active. It is reported from British Isl

Immediate cardiac care (24- 72 hours) after operation, Immediate Care (24...

Immediate Care (24- 72 hours) All monitoring and medications continued. Flushing of arterial lines are done at regular intervals with heparin flush as well as whenever art

Protonephridia and metanephridia, Protonephridia and Metanephridia Ne...

Protonephridia and Metanephridia Nephridia take place in two major forms - the protonephridium and metanephridium. Protonephridia are found in flat worms. The protonephridial

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd