Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
In the early 1970's, Schroeder and his group designed a single stage implant system known by the name of ITI Implant System. They demonstrated that one-stage implant can also result in direct bone to implant contact and named this phenomenon as "functional ankylosis". The initial surface characteristics was plasma sprayed titanium coating which in recent years have changed to a sand blasted acid etched surface.
why are they called as pisces
Explain the Etiology and Clinical Features of Parkinson's disease? The cause of Parkinson's is unknown. Genetic predisposition (in most cases the reason for the death of these
Q What are the major functions of the blood? The blood is a means of substance transportation throughout the body. The blood distributes hormones, nutrients, oxygen, cells and
What is the Echocardiogram ? When doubts persist whether a patient has CHD or not despite a thorough clinical exam and chest X-ray, ECG, and hyperoxia test, an echocardiogram s
Define Voriconazole It is metabolized in the liver by CYP2C19, CYP2C9 and CYP3A4. CYP2C19 is genetically variant (about 3% to 5% of Caucasians and African-Americans and about 1
Define the Primary Stain and Mordant? (i) Primary Stain - Crystal violet is the primary or first stain, which stains all the cells violet/purple. (ii) Mordant - Gram's iodin
Explain the Physical Methods to Control Microorganisms? The physical methods to control microorganisms involve heat, filtration or radiations. Figure illustrates these methods.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How to calculate the magnifying power of a microscope i
What is the Classification of Burns? Burns can be classified on the basis of the extent, depth, patient age and associated illness or injury. On the basis of depth, burns are u
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd