Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Illustrate the metabolism of cornea?
Metabolism of Cornea:
The corneal epithelium plays several roles in the process of image formation. Its apical cell border interacts with the tear matrix to obtain an optically smooth surface and extremely regular thickness. Corneal smoothness is evaluated with a Placido's disc. Tight packing of individual epithelial cells is by the many desmosomes. The scattering of light by the epithelial cells decreases the clarity of image. The process that leads to variation of refractive index within the epithelial cells decreases the clarity of image, for example, corneal edema either due to intraepithelial cell edema or intracellular edema. The common cause of intraepithelial cell edema is epithelial hypoxia resulting from contact lens over wear or intercellular edema may result from high IOP, as is seen in acute angle closure glaucoma.
Q Are there non-parasitic viruses? All viruses are necessitating intracellular parasites that are they depend on the host cell to complete their life cycle. A virus does not ha
Draw and describe the structure of amphibian,reptile mammal and bird
How do you determine if a molecule is polar or non-polar? A polar molecule is a molecule that has a net dipole moment because of its having unsymmetrical polar bonds
Define the role of Immunoglobin E in Food Allergy? Immunoglobin E (IgE) helps to eliminate parasites (helminthes) and is responsible for classic allergic reactions commonly ref
Acetylcholine, a well known neurotransmitter, plays a critical synaptic role in the initial formation of memory. Chemical blockage of the acetylcholine receptors makes it harder to
When the action potential reaches the nerve terminal it causes the let go of a chemical neurotransmitter by the synaptic vesicles. Mammalian nervous system employs many substances
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
NON-PROTEI N AMINO ACIDS Non-protein amino acids are the ones which are not incorporated in proteins but occur freely or in combined state in non-protein substances. Their
Behavior means responses or reactions or acting in any situation. Change means act of changing or to become different or to modify. Behaviour Change can refer to any modifica
You have discovered that a single protein in two different cell lines is significantly over expressed in one of them. The proteins are identical, yet Northern blot analysis has dem
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd