Illustrate the metabolism of cornea, Biology

Assignment Help:

Illustrate the metabolism of cornea?

Metabolism of Cornea:

The corneal epithelium plays several roles in the process of image formation. Its apical cell border interacts with the tear matrix to obtain an optically smooth surface and extremely regular thickness. Corneal smoothness is evaluated with a Placido's disc. Tight packing of individual epithelial cells is by the many desmosomes. The scattering of light by the epithelial cells decreases the clarity of image. The process that leads to variation of refractive index within the epithelial cells decreases the clarity of image, for example, corneal edema either due to intraepithelial cell edema or intracellular edema. The common cause of intraepithelial cell edema is epithelial hypoxia resulting from contact lens over wear or intercellular edema may result from high IOP, as is seen in acute angle closure glaucoma.


Related Discussions:- Illustrate the metabolism of cornea

Are there non-parasitic viruses, Q Are there non-parasitic viruses? All...

Q Are there non-parasitic viruses? All viruses are necessitating intracellular parasites that are they depend on the host cell to complete their life cycle. A virus does not ha

Veterbrate, Draw and describe the structure of amphibian,reptile mammal and...

Draw and describe the structure of amphibian,reptile mammal and bird

How do you determine if a molecule is polar or non-polar, How do you determ...

How do you determine if a molecule is polar or non-polar? A polar molecule is a molecule that has a net dipole moment because of its having unsymmetrical polar bonds

Define the role of immunoglobin e in food allergy, Define the role of Immun...

Define the role of Immunoglobin E in Food Allergy? Immunoglobin E (IgE) helps to eliminate parasites (helminthes) and is responsible for classic allergic reactions commonly ref

Acetylcholine - long term potentiation, Acetylcholine, a well known neurotr...

Acetylcholine, a well known neurotransmitter, plays a critical synaptic role in the initial formation of memory. Chemical blockage of the acetylcholine receptors makes it harder to

What is neurotransmitters , When the action potential reaches the nerve ter...

When the action potential reaches the nerve terminal it causes the let go of a chemical neurotransmitter by the synaptic vesicles. Mammalian nervous system employs many substances

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Non-protein amino acids, NON-PROTEI N AMINO ACIDS Non-protein amino ac...

NON-PROTEI N AMINO ACIDS Non-protein amino acids are the ones which are not incorporated in proteins but occur freely or in combined state in non-protein substances. Their

Behaviour change communication, Behavior means responses or reactions or ac...

Behavior means responses or reactions or acting in any situation. Change means act of changing or to become different or to modify. Behaviour Change can refer to any modifica

How lead to over expression of the protein, You have discovered that a sing...

You have discovered that a single protein in two different cell lines is significantly over expressed in one of them. The proteins are identical, yet Northern blot analysis has dem

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd