Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Which are the subproducts of the photochemical phase that are essential for the chemical stage of photosynthesis?
The chemical stage of photosynthesis depends on ATP and NADPH produced in the "light reactions" (photochemical stage).
HIS T O R Y - Protoplasm was first seen by Corti, 1772 F . Dujardin called it "Sarcode" & observed it in animal cell Term "Protoplasm" was given by J.E. Pu
Q. Which chemical element is the central in the chlorophyll molecule? The chemical element that is the central in the chlorophyll molecule is magnesium. One atom of magnesium
Osler's nodes are small, tender subcutaneous nodules that develop in the pulp of the digits or occasionally more proximally in the fingers and persist for hours to several days. Th
Determine amount of intracellular potassium ions in neuron A Neuron A is a healthy neuron with all the usual ion channels. When at rest with a membrane voltage of R millivolts
Planning the Nursing Care Monitor fluid intake and urinary output Administer drugs as advised/prescribed Monitor the child on dialysis Provide therapeutic diet
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Body Mass Index (BMI)? Weight for height as a marker of nutritional status has the advantage that it is independent of other factors that affect foetal outcome such as m
Q. Define X-Ray Chest and Coronary Angiography? X-Ray Chest It shows cardiomegaly with left ventricle (LV) and left atrium (LA) enlargement. There may be signs of pulmona
Determine the Food Sources of Fluoride? The major source of fluoride in most diets is water, with foods providing only about 25% of total intake. These include tea and marine f
Subphylum Sarcodiha Pseudopodia typically present; flagella present in developmental stages of some species; free living or parasitic. Superclass - Rhizopoda Loc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd