Illustrate photochemical phase, Biology

Assignment Help:

Q. Which are the subproducts of the photochemical phase that are essential for the chemical stage of photosynthesis?

The chemical stage of photosynthesis depends on ATP and NADPH produced in the "light reactions" (photochemical stage).


Related Discussions:- Illustrate photochemical phase

History of protoplasm, HIS T O R Y - Protoplasm was first seen b...

HIS T O R Y - Protoplasm was first seen by Corti, 1772 F . Dujardin called it "Sarcode" & observed it in animal cell Term "Protoplasm" was given by J.E. Pu

Chemical element is the central in the chlorophyll molecule, Q. Which chemi...

Q. Which chemical element is the central in the chlorophyll molecule? The chemical element that is the central in the chlorophyll molecule is magnesium. One atom of magnesium

Systemic emboli, Osler's nodes are small, tender subcutaneous nodules that ...

Osler's nodes are small, tender subcutaneous nodules that develop in the pulp of the digits or occasionally more proximally in the fingers and persist for hours to several days. Th

Determine amount of intracellular potassium ions in neuron a, Determine amo...

Determine amount of intracellular potassium ions in neuron A Neuron A is a healthy neuron with all the usual ion channels.  When at rest with a membrane voltage of R millivolts

Planning and implementing nursing care - acute renal failure, Planning the ...

Planning the Nursing Care Monitor fluid intake and urinary output  Administer drugs as advised/prescribed  Monitor the child on dialysis  Provide therapeutic diet

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define body mass index (bmi), Define Body Mass Index (BMI)? Weight for ...

Define Body Mass Index (BMI)? Weight for height as a marker of nutritional status has the advantage that it is independent of other factors that affect foetal outcome such as m

Define x-ray chest and coronary angiography, Q. Define X-Ray Chest and Coro...

Q. Define X-Ray Chest and Coronary Angiography? X-Ray Chest It shows cardiomegaly with left ventricle (LV) and left atrium (LA) enlargement. There may be signs of pulmona

Determine the food sources of fluoride, Determine the Food Sources of Fluor...

Determine the Food Sources of Fluoride? The major source of fluoride in most diets is water, with foods providing only about 25% of total intake. These include tea and marine f

Subphylum sarcodiha, Subphylum Sarcodiha Pseudopodia typically presen...

Subphylum Sarcodiha Pseudopodia typically present; flagella present in developmental stages of some species; free living or parasitic. Superclass - Rhizopoda Loc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd