Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. In which meiotic division does the separation of the homologous take place and what are the ploidies of the generated cells after the end of that process?
The separation of the homologous chromosomes occurs in the first division of meiosis I or meiosis. After the end of this cell division two haploid cells are made, each having different chromosomes with no set of homologous. Note that in the cells generated after meiosis I each chromosome is still duplicated from the time when the homologous chromosomes and not the identical chromatids were separated.
Explain the Nature of fatty acids present in the triglyceride? Nature of fatty acids present in the triglyceride determines the physico-chemical properties and biological signi
How to calculate the Net Protein Utilization (NPU)? Mitchell (1922) introduced the term 'Net Utilization of Dietary Protein' which is a product of digestibility coefficient and
In 1809, Maggiolo described a process of fabricating and inserting gold roots into freshly extracted sockets. The implant was constructed from the three pieces of gold which were s
What is transgenic food? Transgenic beings are animals, microorganisms and plants that have recombinant DNA, i.e., genes from other plants, microorganisms or animals artificial
What is the molecular composition of hemoglobin? Does the functionality of hemoglobin as a protein depend upon its tertiary or upon its quaternary structure? Hemoglobin is a mo
Q What are pneumatic bones? Birds have lightweighted bones with internal spaces filled with air. These bones are called pneumatic bones this feature reduces the corporal densit
Avian reovirus infections There are several avian reoviuses isolated from chicken, turkey and other species of birds. They are associated with arthritis (tenosynovitis), respir
What is an example of an ion of biological importance? Sodium in one, but so are potassium and calcium
I want to do assignment on kerb cycle with in text citation
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd