Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. In which meiotic division does the separation of the homologous take place and what are the ploidies of the generated cells after the end of that process?
The separation of the homologous chromosomes occurs in the first division of meiosis I or meiosis. After the end of this cell division two haploid cells are made, each having different chromosomes with no set of homologous. Note that in the cells generated after meiosis I each chromosome is still duplicated from the time when the homologous chromosomes and not the identical chromatids were separated.
Explain Food lipids It is either consumed in the form of "visible" fats, which have been separated from the original plant or animal sources, such as vegetable oil and butter,
CAUSES OF EXTINCTION - 1 . HUNTING - Man started hunting wild animlas for food and safety trade and fun. It may be subsistence hunting, commercial hunting and sp
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
ROLE OF ENZYMES IN METABOLISM Enzymes require a non-protein part for their optimal activity, which may be a coenzyme or a metal ion. This has also been stated earlier that
Reproduction
Explain Adverse Effects of Oseltamivir Nausea and vomiting can occur. Taking the drug with food decreases the incidence of nausea. In juvenile rats, very high doses of osel
Q. Function of Dopamine in consciousness? An increase in dopamine activity produces an increase in wakefulness. Dopaminergic neurons in the ventral tegmental areas are constant
Define the Sources of Vitamin E? Vitamin E is present in almost all foodstuffs. It is found in wheat germ, corn, nuts, seeds, olives, spinach, asparagus and other green leafy v
What are the predominating chemical compounds respectively in eggshell, white and yolk? The eggshell is essentially made of calcium carbonate. The white, or albumen, is compose
RECAPITUL A TIO N THEORY / BIOGENETIC LAW It was proposed by Muller & Haeckel on the basis of Baer's law. According to it, in the development of animal phylum characters
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd