Illustrate meiotic division, Biology

Assignment Help:

Q. In which meiotic division does the separation of the homologous take place and what are the ploidies of the generated cells after the end of that process?

The separation of the homologous chromosomes occurs in the first division of meiosis I or meiosis. After the end of this cell division two haploid cells are made, each having different chromosomes with no set of homologous. Note that in the cells generated after meiosis I each chromosome is still duplicated from the time when the homologous chromosomes and not the identical chromatids were separated.


Related Discussions:- Illustrate meiotic division

Explain food lipids, Explain Food lipids It is either consumed in the ...

Explain Food lipids It is either consumed in the form of "visible" fats, which have been separated from the original plant or animal sources, such as vegetable oil and butter,

Causes of extinction, CAUSES OF EXTINCTION - 1 .       HUNTING - ...

CAUSES OF EXTINCTION - 1 .       HUNTING - Man started hunting wild animlas for food and safety trade and fun. It may be subsistence hunting, commercial hunting and sp

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Role of enzymes in metabolism, ROLE OF ENZYMES IN METABOLISM Enzymes re...

ROLE OF ENZYMES IN METABOLISM Enzymes require a non-protein  part  for  their optimal activity, which may be  a coenzyme or a metal ion. This has also been  stated earlier that

Explain adverse effects of oseltamivir, Explain Adverse Effects of Oseltami...

Explain Adverse Effects of Oseltamivir  Nausea and vomiting can occur. Taking the drug with food decreases the incidence of nausea. In juvenile rats, very high doses of osel

Function of dopamine in consciousness, Q. Function of Dopamine in conscious...

Q. Function of Dopamine in consciousness? An increase in dopamine activity produces an increase in wakefulness. Dopaminergic neurons in the ventral tegmental areas are constant

Define the sources of vitamin e, Define the Sources of Vitamin E? Vitam...

Define the Sources of Vitamin E? Vitamin E is present in almost all foodstuffs. It is found in wheat germ, corn, nuts, seeds, olives, spinach, asparagus and other green leafy v

What are the predominating chemical compounds, What are the predominating c...

What are the predominating chemical compounds respectively in eggshell, white and yolk? The eggshell is essentially made of calcium carbonate. The white, or albumen, is compose

Theory of embryology -recapitulation theory / biogenetic law, RECAPITUL A ...

RECAPITUL A TIO N THEORY / BIOGENETIC LAW It was proposed by Muller & Haeckel on the basis of Baer's law. According to it, in the development of animal phylum characters

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd