Illustrate meiotic division, Biology

Assignment Help:

Q. In which meiotic division does the separation of the homologous take place and what are the ploidies of the generated cells after the end of that process?

The separation of the homologous chromosomes occurs in the first division of meiosis I or meiosis. After the end of this cell division two haploid cells are made, each having different chromosomes with no set of homologous. Note that in the cells generated after meiosis I each chromosome is still duplicated from the time when the homologous chromosomes and not the identical chromatids were separated.


Related Discussions:- Illustrate meiotic division

Explain nature of fatty acids present in the triglyceride, Explain the Natu...

Explain the Nature of fatty acids present in the triglyceride? Nature of fatty acids present in the triglyceride determines the physico-chemical properties and biological signi

How to calculate the net protein utilization (npu), How to calculate the Ne...

How to calculate the Net Protein Utilization (NPU)? Mitchell (1922) introduced the term 'Net Utilization of Dietary Protein' which is a product of digestibility coefficient and

Maggiolo, In 1809, Maggiolo described a process of fabricating and insertin...

In 1809, Maggiolo described a process of fabricating and inserting gold roots into freshly extracted sockets. The implant was constructed from the three pieces of gold which were s

What is transgenic food, What is transgenic food? Transgenic beings are...

What is transgenic food? Transgenic beings are animals, microorganisms and plants that have recombinant DNA, i.e., genes from other plants, microorganisms or animals artificial

What is the molecular composition of hemoglobin, What is the molecular comp...

What is the molecular composition of hemoglobin? Does the functionality of hemoglobin as a protein depend upon its tertiary or upon its quaternary structure? Hemoglobin is a mo

What do you mean by pneumatic bones, Q What are pneumatic bones? Birds ...

Q What are pneumatic bones? Birds have lightweighted bones with internal spaces filled with air. These bones are called pneumatic bones this feature reduces the corporal densit

Poultry and duck diseases-avian reovirus infections, Avian reovirus infecti...

Avian reovirus infections There are several avian reoviuses isolated from chicken, turkey and other species of birds. They are associated with arthritis (tenosynovitis), respir

What is an example of an ion of biological importance, What is an example o...

What is an example of an ion of biological importance? Sodium in one, but so are potassium and calcium

Kreb cycle assignment, I want to do assignment on kerb cycle with in text c...

I want to do assignment on kerb cycle with in text citation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd