Illustrate chloroplast structure, Biology

Assignment Help:

Q. In which chloroplast structure are chlorophyll molecules found?

Chlorophyll molecules are placed in an organized manner in order to improve the exposure to light on the thylakoid surfaces.


Related Discussions:- Illustrate chloroplast structure

Public-private dichotomy in providing health services, Normal 0 ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain phylum bryophyta, Phylum Bryophyta The Bryophytes include the m...

Phylum Bryophyta The Bryophytes include the mosses and their close relatives. They are widely diverse and grow in a variety of place. 1) Life cycle shows alternation of gene

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Emf, In a neuron with a resting potential of -65 mV, the distribution of wh...

In a neuron with a resting potential of -65 mV, the distribution of which ion across the neuronal membrane represents the greatest potential electromotive force (EMF)? A. Potassiu

Tissue distribution and regulation of calcium concentration, Define Tissue ...

Define Tissue Distribution and Regulation of Calcium Concentration? As already discussed, development and preservation of bone mass is quantitatively an important function of c

Explain genital herpes, Explain Genital herpes Acyclovir  (Zovirax,  a...

Explain Genital herpes Acyclovir  (Zovirax,  and others), famciclovir (Famvir) or valacyclovir (Valtrex) taken orally for 7-10 days shortens the duration of pain, viral sheddi

Mitral valve replacement -mitral valve disease, Mitral Valve Replacement : ...

Mitral Valve Replacement :  Patients who require surgery and are not candidates for BMV, CMV or OMV should have mitral valve replacement (MVR). Types of Surgery for Mitra

How can the visual deficiencies known as myopia, How can the visual deficie...

How can the visual deficiencies known as myopia and hypermetropia be optically explained? Myopia is the visual condition in which the images are produced before (in front of)

Animal cells, how to explain the structure and function of the organelle

how to explain the structure and function of the organelle

Social determinants of health - food, Social Determinants of Health - Food ...

Social Determinants of Health - Food The twin paradox of food i.e., research showing excessive intake can lead to a variety of diseases whilst at the same time food poverty be

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd