Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. In which chloroplast structure are chlorophyll molecules found?
Chlorophyll molecules are placed in an organized manner in order to improve the exposure to light on the thylakoid surfaces.
PARATHYRIOD GLANDS - They develop from the endoderm of the embryo. The parathyroid glands consist of four separate glands located on the posterior surface of the lobes of
Intermediate filaments - Role of Cytoskeleton Structures These filaments are intermediate in size among microtubules and microfilaments and are 10 nm in diameter. Five classes
In the scientific competition against fixism what are the main arguments that favor evolutionism? The major arguments in favor of evolutionism are paleontological, from the stu
JOINTS - The structural arrangement of tissues which connect 2 or more bones together at their place of meeting is called a joint. Study of joint is arthrology. Joint make the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Spiral Cleavage - Metazoa In Spiral Cleavage, however, the third and fourth cleavage planes are oblique to the polar axis and the resulting blastomeres do not lie on top of on
Q. Can you explain Aneurysm of Aorta? CXR findings are an enlargement of the involved portion of the aorta. A focal dilatation may simulate a mass or adenopathy. A more general
WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL
Q. Vitamins and minerals requirement in chronic diarrhoea? Loss of vitamins is related to the degree of mucosal damage in chronic diarrhoea, which in turn impairs absorption an
Elaborate the term - Gill slits. Lateral opening in the wall of pharynx which allows water to enter into mouth and exit through the pharynx. This is one of the ancestral charac
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd