Hypothesis - nursing research, Biology

Assignment Help:

Hypothesis:

The  spelling of hypothesis when written  as  "hypotheses"  indicate plural. The hypothesis is a statement or declaration of  the expected outcome of a research study. Often it is called as an educated guess or hunch that the researcher proposes for testing.  It  is based  on  logical-rationale and has empirical possibilities  for  its testing,  i.e. using statistical methods. Hypothesis provides a statement about a specific relationship  to be  tested. Refer  to Example  12 which is  a statement showing the researcher's hunch on the relationship between breathing exercises and post-operative respiratory complications  in patients undergoing surgery. 

Normally,  in  an  hypothesis there are  four  elements: (i) dependent and independent variables,  (ii) some  type of  relationship between independent and dependent variable, (iii) the direction of change,  i.e.  stating  "more  or less",  "higher or lower" increased or decreased, and  (iv) it mentions  the subject,  i.e.  the population being studied. Can you  identify these elements  in the' exercise (Activity 6) given at  the  end of this unit. The type of variables here,  seem to have a cause and effect relationship,  i.e.  the exercise  is  the cause and the effect  is  the reduction  of  respiratory complications. We  cannot absolutely assure this. Remember those innumerable variables, some of which are shown  in  Example  1. These other variables may  also influence reduction  of complications.  In nursing studies it  is  difficult  to  control all variables  as  the subjects and the researchers are also human being and are all-different. You may appreciate that patients, doctors, nurses are heterogeneous in nature and  it is  difficult  to  control human qualities.  


Related Discussions:- Hypothesis - nursing research

Hazards of oxygen therapy - respiratory failure, Hazards of O 2 Therapy ...

Hazards of O 2 Therapy Exposure to greater than 60 per cent O 2 , for a period of more than 36 hours, or exposure to 100 per cent 0, for a period of more than 6 hours, res

Guards for machines and equipment, Guards for Machines and Equipment ...

Guards for Machines and Equipment Various machines and equipment used for manufacturing require guards for protecting the operator from any injury. These machines include: Wo

Principles of haccp, Principles of HACCP A) Determine the  Critical  Co...

Principles of HACCP A) Determine the  Critical  Control  Points  (CCPs) B) Establish  Critical Limit(s) C) Establish a  System  to  Monitor Control of the  CCP D) Esta

Ventilation of tracheal system, Ventilation of Tracheal System The man...

Ventilation of Tracheal System The manner in which tracheae are ventilated varies with species of insects but movement of air is achieved in two ways: Diffusion

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about non-nutritive sweeteners, Q. Explain about Non-Nutritive Swee...

Q. Explain about Non-Nutritive Sweeteners? Non-Nutritive Sweeteners: These are characterized by an intense sweet taste. They are needed in small quantities and do not make any

What is a skiers launch speed, In the aerials competition in skiing, the co...

In the aerials competition in skiing, the competitors speed down a ramp that slopes sharply upward at the end. The sharp upward slope launches them into the air, where they perform

What are the types of nutrients, Q. What are the types of nutrients? Explai...

Q. What are the types of nutrients? Explain the functions of nutrients? Types of nutrients  • Carbohydrates • Proteins • Fats • Minerals • Vitamins • Water Fu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd