Hypothalamus and pituitary, Biology

Assignment Help:

Hypothalamus and Pituitary

The most obvious neuroendocrine link is between the hypothalamus and pituitary. The hypothalamus is a part of the brain which is connected to the pituitary gland a small organ situated in the floor of the skull just above the roof of the mouth.

2412_Hypothalamus and Pituitary.png

Figure: Hypothalamus and Pituitary

 


Related Discussions:- Hypothalamus and pituitary

How ph affect the initial rate of an enzyme, How does pH affect the initial...

How does pH affect the initial rate of an enzyme -catalyzed reaction?

Explain the working of conical flasks, Explain the working of Conical Flask...

Explain the working of Conical Flasks? Conical flasks of different volumes can be used for media preparation and also for culturing large amount of microorganisms in liquid med

What are the major parts of ferns, Q. What are the major parts of ferns? ...

Q. What are the major parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome stem and often horizontalized. The fronds also arise from the rh

What do you mean by syphilis, Q. What do you mean by syphilis? The Syph...

Q. What do you mean by syphilis? The Syphilis, as well known as lues, is a disease caused by the bacteria Treponema pallidum. Before the invention of penicillin, syphilis was a

Relate mitochondria organelles with eukaryotic cells, Relate Mitochondria o...

Relate Mitochondria organelles with eukaryotic cells Mitochondria are highly specialised organelles in eukaryotic cells. These perform the energy transducing process, and are o

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain adverse effects of valacyclovir, Adverse Effects of Valacyclovir  ...

Adverse Effects of Valacyclovir  Valacyclovir is generally well tolerated; adverse effects are similar to those with acyclovir. GI disturbance, headache, rash, CNS effects such

Explain the ethological approach in taxonomy, Explain the Ethological Appro...

Explain the Ethological Approach in Taxonomy The use of behavioural or ethoIogica1 characteristics in animals is relatively new, though extremely useful, particularly in the id

Contractile vacuole - protozoans, Contractile vacuole - Protozoans The...

Contractile vacuole - Protozoans The contractile vacuoles may differ in complexity in various groups of protozoans. In amoebae the vacuoles are carried around in the cytoplasm

Carbohydrate requirement during congestive cardiac failure, Q. Carbohydrate...

Q. Carbohydrate requirement during congestive cardiac failure? While the quantity of carbohydrate remains almost the same as per the RDI i. e, 60% of the total energy, the qual

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd