Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Hypothalamus and Pituitary
The most obvious neuroendocrine link is between the hypothalamus and pituitary. The hypothalamus is a part of the brain which is connected to the pituitary gland a small organ situated in the floor of the skull just above the roof of the mouth.
Figure: Hypothalamus and Pituitary
How does pH affect the initial rate of an enzyme -catalyzed reaction?
Explain the working of Conical Flasks? Conical flasks of different volumes can be used for media preparation and also for culturing large amount of microorganisms in liquid med
Q. What are the major parts of ferns? Ferns are constituted by small roots that come downwards from the rhizome stem and often horizontalized. The fronds also arise from the rh
Q. What do you mean by syphilis? The Syphilis, as well known as lues, is a disease caused by the bacteria Treponema pallidum. Before the invention of penicillin, syphilis was a
Relate Mitochondria organelles with eukaryotic cells Mitochondria are highly specialised organelles in eukaryotic cells. These perform the energy transducing process, and are o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Adverse Effects of Valacyclovir Valacyclovir is generally well tolerated; adverse effects are similar to those with acyclovir. GI disturbance, headache, rash, CNS effects such
Explain the Ethological Approach in Taxonomy The use of behavioural or ethoIogica1 characteristics in animals is relatively new, though extremely useful, particularly in the id
Contractile vacuole - Protozoans The contractile vacuoles may differ in complexity in various groups of protozoans. In amoebae the vacuoles are carried around in the cytoplasm
Q. Carbohydrate requirement during congestive cardiac failure? While the quantity of carbohydrate remains almost the same as per the RDI i. e, 60% of the total energy, the qual
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd