Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Hyperthyroidism (Graves Disease):
Graves diseases is the most common cause of hyperthyroidism in children and is usually associated with an enlarged thyroid gland and exophthalmus. The peak incidence of the disease occurs between 12 and 14 years of age, but it may be present at birth in children of thyrotoxic mothers, The incidence is five times higher in girls than in boys. There is no specific cause of this disease but it is apparently caused by a serum thyroid stimulating immunoglobulin and has familial association; a large number of persons with the diseAse possess the histocompatibility antigenc (HLA-B8). The child presents the signs and symptoms such as; emotional liability, restlessness, low school performance, fatigue, tachycardia, dyspnea on exertion, exophthalmos tremor, goiter, warm moist skin, heat intolerance, systolic murmur, thyroid storm such as severe irritability, anorexia and weightloss vomiting, diarrhoea, hyperthyroidism, hypertension, severe tachycardia, prostration. This may lead to delirium coma and death. Therapeutic management consists of anti thyroid drugs, subtotal thyroidectomy and ablation with radio iodine (131 - lodide). The children should be advised to restrict vigorous exersion until1 thyroid levels are decreased to normal.
diseases of the large intestine
state 5 advantages and disadvantages of protozoa
Illustrate the Structure and functions of aqueous humour Aqueous humour is a clear fluid that fills the anterior and posterior chambers of the eye and permeates the vitreous. I
Q. What do you mean by synapses? Synapses are the structures that transmit the neural impulse between two neurons. When the electric impulse arrives the presynaptic membrane
discuss why obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organisation
living organisms and their excretory products
Define the Features of Cladosporium? Identifying Features of Cladosporium: 1. Colonies are small, heaped, powdery and greenish black in colour. 2. Mycelium is septate and
For the article entitled "The inner life of the genome" which of the following is true? A. Individual chromosomes occupy explained territories within the nucleus. B. The spe
Evolutionary Implications of Natural Regulation Many changes in abundance can be attributed to changes in extrinsic factors such as weather, disease or predation. But some cha
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd