Hyperthyroidism (graves disease), Biology

Assignment Help:

Hyperthyroidism (Graves Disease):

Graves diseases is  the most common cause of hyperthyroidism  in  children and is usually associated with an  enlarged thyroid gland and exophthalmus. The peak  incidence of the disease occurs between 12 and  14  years of age,  but  it may  be present at birth  in  children of thyrotoxic mothers, The  incidence is five times higher  in  girls than  in  boys. There is no specific cause of this disease but it  is apparently caused by  a serum  thyroid stimulating immunoglobulin and has familial association; a  large number of  persons with  the diseAse possess the histocompatibility  antigenc (HLA-B8). The child presents the signs and symptoms such as; emotional liability, restlessness, low school performance, fatigue, tachycardia, dyspnea on exertion, exophthalmos tremor, goiter, warm moist skin, heat  intolerance, systolic murmur, thyroid storm such as severe irritability, anorexia and weightloss vomiting, diarrhoea,  hyperthyroidism, hypertension, severe tachycardia, prostration. This may  lead  to delirium coma and  death. Therapeutic management consists of anti  thyroid drugs, subtotal thyroidectomy and ablation with  radio iodine (131 - lodide). The children should be advised to restrict vigorous exersion  until1 thyroid levels are decreased  to normal.  


Related Discussions:- Hyperthyroidism (graves disease)

Protozoa., state 5 advantages and disadvantages of protozoa

state 5 advantages and disadvantages of protozoa

Illustrate the structure and functions of aqueous humour, Illustrate the St...

Illustrate the Structure and functions of aqueous humour Aqueous humour is a clear fluid that fills the anterior and posterior chambers of the eye and permeates the vitreous. I

What do you mean by synapses, Q. What do you mean by synapses? Synapses...

Q. What do you mean by synapses? Synapses are the structures that transmit the neural impulse between two neurons. When the electric impulse arrives the presynaptic membrane

Animal biodiversity, discuss why obelia is considered to be of special inte...

discuss why obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organisation

Excretion, living organisms and their excretory products

living organisms and their excretory products

Define the features of cladosporium, Define the Features of Cladosporium? ...

Define the Features of Cladosporium? Identifying Features of Cladosporium: 1. Colonies are small, heaped, powdery and greenish black in colour. 2. Mycelium is septate and

What is the inner life of the genome, For the article entitled "The inner l...

For the article entitled "The inner life of the genome" which of the following is true? A. Individual chromosomes occupy explained territories within the nucleus. B. The spe

Evolutionary implications of natural regulation, Evolutionary Implications ...

Evolutionary Implications of Natural Regulation Many changes in abundance can be attributed to changes in extrinsic factors such as weather, disease or predation. But some cha

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd