Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Hydrophilicity Plot is a computer plot which checks the relative summed hyrophobicity or hydrophilicity of adjacent amino acid sidechains (usually within a moving window of about 6 amino acid residues) along with the the primary sequence of a polypeptide chain. Values for contribution of sidechains of each the 20 common amino acids to hydrophobicity or hydrophilicity have been developed by Hopp & Woods, and Kyte & Doolittle, and these plots are generally named after these workers. Usually, hydrophobic regions of proteins are considered likely to be in the interior of the native protein, whereas hydrophilic domains are probable to be exposed on the surface and thus possibly antigenic sites (epitopes). At best, these are crude predictions.
S n a c k Products Meat snacks such as curls; chips are made from sliced, whole meat and comminuted meat. Extruded snacks are made from meat and non meat ingredients. Extru
steps involved in glycolysis
Determine Fat Soluble Vitamin Needs of school children and adolescents? ICMR (1990) does not give recommendations for vitamin D, E and K. Vitamin D is very important for skelet
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How Can Total Count Can Be Obtained? Total count can be obtained microscopically by using fluorescent dyes such as acridine orange or DNA stain DAPI. The counts obtained micros
Flowering - Development of plant One of the major changes that occur during the life cycle of a plant is the transition from vegetative stage to the flowering stage. In this t
Q. Can we make artificial cells? Research in progress at the "National Aeronautical and Space Administration (NASA)" is focused on artificial cells as a means to deliver medici
Basic characters of vertebrate classes
Results: Early mortality for tricuspid valve replacement is around six per cent. But depending on the patient's class of symptoms and the number of concomitant procedures, this c
Q. What are the main factors that affect the growth of a population? The major factors that make populations grow are births and immigration. The major factors that make popula
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd