Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
HUMAN SKELETON -
Hard supportive or protective elements of the animal body form the skeleton system. It's study in osteology.
EXOSKELETON -
Present outside skin. It consists of nails, hair etc. Keratine protein present.
Covers the body. Produced by ectoderm. Consists of non-living material. May be moulted periodically during growth.
ENDO SKELETON -
Occurs inside body. Produced by mesoderm. Consists of skeletal tissue as bones & cartilage.
What is a population? A population is a set of individuals of the similar species found in a given place in a given time.
note
Explain the neuritic type of infantile beriberi? It is also referred to as Wernicke korsakoff syndrome or cerebral beriberi. It shows typical manifestations of peripheral neuro
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Sexual Reproduction ? In most higher organisms, replication occurs by sexual reproduction. Sexual reproduction begins with a process called meiosis. The products of me
Why is it advantageous to have weak hydrogen bonds among complementary bases and strong covalent bonds among phosphate and Deoxyribose groups in a DNA molecule? The hydrogen bo
Explain the Toxicity of nicotinic acid? Although therapeutically useful in lowering serum cholesterol, administration of chronic high oral doses of nicotinic acid can lead to h
which area of the basal nuclei is responsible for controlling appendicular muscle tone?
Nuclease is an enzyme which degrades the nucleic acids. A nuclease can be DNA-specific (a DNase), RNA-specific (RNase) or non-specific. It might act only on single stranded nuclei
Closed Mitral Valvotomy : This has been 1-eplaced by balloon mitral valvotomy (BMV) in most centres. It is done in cases of either pure mitral stenosis or with .triv
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd