Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
HUMAN SKELETON -
Hard supportive or protective elements of the animal body form the skeleton system. It's study in osteology.
EXOSKELETON -
Present outside skin. It consists of nails, hair etc. Keratine protein present.
Covers the body. Produced by ectoderm. Consists of non-living material. May be moulted periodically during growth.
ENDO SKELETON -
Occurs inside body. Produced by mesoderm. Consists of skeletal tissue as bones & cartilage.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the meaning of Oedema? In some pathological conditions the body is in a positive water balance; that is the intake of fluids is greater than the excretion, and the pati
assignment on prolactin
Determine the Muscular-Skeletal System It is known we all do movement and these take place by movement of muscles in coordination with the skeletal system. In human body muscle
Define Classification of Lipids? Chemically, lipids are the organic molecules poor in oxygen content, soluble in organic solvents but insoluble in water. They are classified as
Considering hybridization in a trait like the color of the flowers of a given plant species (red/yellow) conditioned by a pair of different alleles in relation to complete dominanc
how to know what type of blood are?
Explain performance testing of fats and oil In these cases, performance testing is the only means for evaluating the ability of fat or oil to perform the desired functions in a
Animal studies Most toxicological data for risk assessment are derived from the animal studies and it is, therefore, essential that these studies be conducted following widel
Q. What is the function of the plant cell wall? The plant cell wall has protective and structural functions. It plays an significant role in the constraint of the cell size, pr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd