Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Human Population-Historical Overview
Throughout history, the human population has been quite small. It has grown relatively slowly and even experienced occasional declines. Figure shows the general trend of population growth in the last half million years. As said earlier, the dawn of agriculture, triggered a series of major global environmental changes.
Figure: Human Population
As agriculture became more efficient, women began to bear more children and the human population increased. It was possible to grow more food in a given area of land. Hunter-gatherers were mostly nomadic and in their way of life, infants were a liability as children could not become very good hunters. Whereas, in a stationary agricultural society, babies are not much trouble and children can help in the farm. Therefore, the population increase between 10,000 BC and about 1800 AD was largely the result of increasing birth rates that coincided with the growth of agriculture.
Coal can be classified into following categories in the order of rank. Peat: peat is a brown and fibrous mass. It is the first stage of coalification. It is not used as
SHORT COMING OF CELL THEORY / EXCEPTIONS OF CELL THEORY (i) Viruses can be considered as exception to cell theory. They are made of proteins and ones of nucleic acid i.e.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Elastase The inactive proelastase is activated by trypsin to the active form elastase. Elastase attacks peptide bonds next to the small amino acid residues such 3s g
What is meant by "post-translational modification"? Give examples of post-translational modifications of the following amino acids: a. Serine b. Lysine C. Choose a third amino acid
Q. What is the vestibular system? How does it operate? The vestibular system is the part of the ear that participates in the regulation and control of the equilibrium of the bo
What is the part of the female reproductive system where fecundation occurs? Fecundation generally happens in the Fallopian tubes but it can also take place within the uterus.
1 ." Most of the genome does not code for protein, therefore 99% of the human genome is junk that serves no purpose". With specific reference to examples long and short non-coding
How to load glycogen? Over the past fifty years, the biggest breakthrough was the discovery of how to load glycogen and sophistication in the methods of glycogen loading. Nitro
Why is the dietary obtainment of iodine so important for thyroid functioning? The obtainment of iodine from the diet is significant for the thyroid because this chemical elemen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd