Human development, Biology

Assignment Help:

Human Development

Human development is a continuous procedure that begins when the ovum from a female is fertilised via sperm from a male to form the zygote. Growth and differentiation transform the zygote into a multicellular adult human being. Though, it is important to realise that development does not stop at birth. It is a continuous procedure. It is usual to divide human development into prenatal and postnatal periods. Prenatal period refers to the period before birth. Throughout this period for the first eight weeks the developing human being is called an embryo since the organ systems are forming. From the 9th week onwards the term foetus is used. The foetal period (9 weeks to birth) is charactrised by growth and elaboration of structures. The postnatal period starts at birth and ends at death. Important developmental changes in addition to growth take place after birth, for example, the development of teeth and the changes during puberty. The brain triples in weight among birth and 16 years of age. Though, most developmental changes are completed by the age of 25.

The 266 days among conception and birth are traditionally divided into about three month periods, each termed as a trimester. We deal with each trimester but more emphasis is given Lo the first trimester as more dramatic changes take place during this period. But before we discuss the development of the human embryo it is significant to recapitulate the process of gametogenesis and the general structure of the female reproductive tract as the entire prenatal period is spent inside the womb of mother.


Related Discussions:- Human development

Proteins of plant origin - seed proteins, Proteins of Plant Origin - Seed P...

Proteins of Plant Origin - Seed Proteins Seed Proteins: Although a large number of plants produce seeds having protein contents in excess of 15%, only a few are utilized for fo

Blood flow during exercise - circulation, Normal 0 false fals...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Factors affecting the rapeutic relationship, FACTORS AFFECTING THE RAPEUTIC...

FACTORS AFFECTING THE RAPEUTIC RELATIONSHIP: A  rapport  is developed between the nurse and  the patient. Rapport  is defined as, a relationship of mutual sympathy and underst

Explain protoderm in primary growth in shoot, Explain Protoderm in primary ...

Explain Protoderm in primary growth in shoot? The protoderm is one of the so-called "primary tissues" because it is formed first during germination and subsequent bud growth an

What are the degenerative diseases of the nervous system, Q. What are the m...

Q. What are the main degenerative diseases of the nervous system? The major degenerative diseases of the nervous system are Alzheimer's disease and Parkinson's disease. The

List out the principles of food preservation, List out the Principles of Fo...

List out the Principles of Food Preservation? All food preservation methods are based upon the general principle of preventing or retarding the causes of spoilage caused by mic

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Ionosinin ic pathway , how ionosinic pathway ric acid from ammonia forms ...

how ionosinic pathway ric acid from ammonia forms u

Definition of diabetes mellitus, Q. DEFINITION OF DIABETES MELLITUS? Th...

Q. DEFINITION OF DIABETES MELLITUS? The word "diabetes" is derived from the Greek word meaning "a siphon". The patients of diabetes had polyuria (passing excessive urine) and "

Define the high blood plasma lh levels and ovulation, Which of the followin...

Which of the following pairs of events in a human female occur at, or nearly at, the similar time during the menstrual cycle? A. High blood plasma LH levels and ovulation. B

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd