How the wet beriberi developed rapidly, Biology

Assignment Help:

How the Wet beriberi Developed Rapidly?

Oedema is the significant feature of wet beriberi. It may develop rapidly and involve not only the legs but also the face, trunk and serous cavities.  Palpitation and breathlessness are present. The calf muscles are frequently tense, slightly swollen and tender on pressure. The veins of the neck are distended and show visible pulsations. The diastolic blood pressure is low and systolic is high. The pulse is fast and bouncing. The heart becomes weak and death occurs because of heart failure.


Related Discussions:- How the wet beriberi developed rapidly

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain pure culture techniques, Explain Pure Culture Techniques We lea...

Explain Pure Culture Techniques We learnt the techniques involved in sub-culturing, i.e., the process involved in transfer of culture from one medium to another or transfer of

What are the substances transferred from the mother to fetus, What are the ...

What are the main substances transferred from the mother to the fetus through the placenta? And from the fetus to the mother? From the mother to the fetus the major transferre

What is increase in the second messenger, When glucagon binds its receptor ...

When glucagon binds its receptor there is an increase in the second messenger, cAMP. cAMP levels can be decrease by which of the following enzymes? -adenylate cyclase -PDK1

Photosynthesis carbon dioxide is improved to form glucose, Q Why is it said...

Q Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.

Requirement of folic acid and vitamin b12 during pregnancy, Determine Requi...

Determine Requirement of Folic acid and vitamin B 12 During pregnancy? Folic acid and vitamin B 12 are important for production of new cells. DNA must replicate and transmit

Water has key participation in organic reactions, Q. Water has key particip...

Q. Water has key participation in organic reactions. What are examples of two types of organic reactions in which water is respectively incorporated or liberated in the products of

Oxygen stratification - lake ecosystem, Oxygen Stratification - Lake Ecosys...

Oxygen Stratification - Lake Ecosystem In most lakes, oxygen stratification nearly parallels that of temperature during the summer season. The amount of oxygen is greatest on

Loading and unloading of sieve tubes, Loading and Unloading of Sieve Tubes ...

Loading and Unloading of Sieve Tubes In order to understand the loading of food from manufacturing leaf cells to sieve tubes we must examine the anatomy of a minor vein shown

Take advantage of retro transposes in human gene therapy, In what way may w...

In what way may we be able to take advantage of retro transposes in human gene therapy? How would this differ from our current use of retroviruses?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd