How the visual images are projected, Biology

Assignment Help:

Since the visual images are projected in an inverted manner on the retina why don't we see things upside down?

As the crystalline lens is a convex spherical lens it forms inverted images on the retina (each converging lens forms inverted images). The inverted information follows by the optical nerves until the occipital cerebral cortex that having the visual area of the brain. In the brain the interpretation of the image takes place and the inverted information is reverted.

 


Related Discussions:- How the visual images are projected

Nutrition - autotrophic nutrition, AUTOTROPHI C NUTRITION Pr...

AUTOTROPHI C NUTRITION Preparation of organic food from the inorganic materials in the living body. May be photoautrophic, e.g. Euglena virdisima. May be chemo

List various liver function tests, Question 1 List various liver function ...

Question 1 List various liver function tests. Discuss the importance of each test. Add a note on standardization of various liver function tests Question 2 Discuss the follow

Why is a leguminous crop rotation used in agriculture, Q. Why is a legumino...

Q. Why is a leguminous crop rotation used in agriculture? The Leguminous crop rotation and other crop rotations are used in agriculture for the reason that in these plants many

Biological species concept, Q. Biological species concept? A biological...

Q. Biological species concept? A biological species as defined by Ernst Mayr are "groups of actually or potentially interbreeding natural populations which are reproductively

What is the antagonism of the sympathetic, What is the antagonism between t...

What is the antagonism between the sympathetic and the parasympathetic neural actions? In general the actions of the sympathetic and the parasympathetic are antagonistic, i.e.,

Reasons for growth of population, REASON S FOR GROWTH OF POPULATION - ...

REASON S FOR GROWTH OF POPULATION - The human population explosion is mainly a result of reduced death rate. Main reasons for it are - 1 .       Protection from natura

Neo-zoonoses, Neo-zoonoses In recent times, some of the pre-existing l...

Neo-zoonoses In recent times, some of the pre-existing low profile and less frequent zoonoses and some entirely newly recognized zoonoses are emerging with a new dimension. Th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

PLASMODIUM LIFE CYCLE, elucidate a life cycle of a plasmodium that causes m...

elucidate a life cycle of a plasmodium that causes malaria

Pericardiocentesis, Pericardiocentesis It is removal of fluid form the...

Pericardiocentesis It is removal of fluid form the pericardial sac. It is a specialized procedure done n ICU or cardiac cath lab or OT. A 16 or 18 gauge needle is inserted

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd