How is the large size of some cephalopods, Biology

Assignment Help:

How is the large size of some cephalopods related to the type of circulatory system they present?

In cephalopods the circulatory system is closed and this gives more speed and pressure for the blood circulation permitting the existence of species with large bodies, such as octopuses and giant squids.

 


Related Discussions:- How is the large size of some cephalopods

What is the natural habitat of e.coli, What is the natural habitat of E.col...

What is the natural habitat of E.coli? The E.coli was first recognized in the colon region of large intestine and so it was given the name "coli" (found in colon) they are coli

Define nervous system and the it's related disorders, Define Nervous System...

Define Nervous System and the it's related disorders? In this unit, we learnt about nervous system and the related disorders, which are termed as 'neurological disorders'. Neur

Define the parathyroid gland cells, Which of the following serves as a sens...

Which of the following serves as a sensor, or as part of a sensor, that functions in a negative feedback system? A. CaSRs (Calcium-Sensing Receptors) located in the plasma memb

What are the uses of construction of a retaining wall, What are the uses of...

What are the uses of construction of a retaining wall? The retaining wall is constructed whenever space requirement do not allow the natural slope to be formed for an excavatio

Signs and symptoms of hypoglycaemia, Q. Signs and Symptoms of Hypoglycaemia...

Q. Signs and Symptoms of Hypoglycaemia? Let us now learn about signs and symptoms of hypoglycaemia. It is important for you know these because you can help the patient and fami

Flightless birds, #Most of the world''s flightless birds are either nocturn...

#Most of the world''s flightless birds are either nocturnal and secretive (e.g. the kagu) or large, swift and well-armed (the ostrich). The exceptions are found primarily on island

Nutrition support for myocardial infarction, Q. Nutrition Support for myoca...

Q. Nutrition Support for myocardial infarction patient? The nutrient requirements of a MI patient vary from time of getting hospitalized in an emergency to the time of getting

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd