Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How does the intensity of simple diffusion differ in relation to the concentration gradient of the moved substance?
The higher the concentration gradient of a substance the supplementary intense its simple diffusion will exist. If the concentration gradient diminishes the intensity of simple diffusion diminishes too.
Explain the Clinical manifestations for Obesity? You must have observed that your overweight friends and colleagues seem to have less energy which makes them an easy prey for f
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Uncompetitive inhibition In this type of inhibition, the inhibitor only binds with the enzyme-substrate complex making it inactive. As a result, the product formation
Describe pulsus parvus et tardus? Pulsus parvus et tardus means a slow rising small volume pulse typically in severe aortic stenosis with preserved LV function. Figur
Q. What are the three stages into which the cell respiration is divided? The three stages of aerobic cell respiration are glycolysis, Krebs cycle and respiratory chain also kno
Cellular Transport Cellular transports demote to the movement of compounds across the outer wall or membrane of the cell. This transport is critical in two respects. Firstly, t
Significance of Apomixis Apomixis offers the possibility of indefinite multiplication of especially favorable biotypes without any variation due to segregation or recombinati
Q. What are the Chronic complications of diabetes? • Atherosclerosis: Degeneration of walls of the arteries due to fatty plaques - deposition on arterial walls. Diabetics ar
Which one of the following is not a micronutrient? 1. Molybdenum 2. Magnesium 3. Zinc 4. Boron. Magnesium
In the human body, the potassium ion can pass easily through cell membranes, yet the potassium ion concentration is higher inside many cells than it is outside these cells. Could t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd