How does iodine kill germs, Biology

Assignment Help:

How does iodine kill germs?

The microbiocidal action of Iodine is because of the active form, I2, which is polarized by water and like all halogens (chlorine, fluorine, bromine, etc.), acts as an extremely potent oxidizer. Activated iodine (I2) reacts in electrophilic reactions with enzymes of the respiratory chain as well as with amino acids located in cell membrane and cell wall proteins.

 


Related Discussions:- How does iodine kill germs

Genetic repatterning during isolation, An island may be colonised by just a...

An island may be colonised by just a few individuals, or just a pair:, or even a single gravid female. When a new population develops from these early colonisers of the island, the

The child''s response to hospitalization, The Child's Response to Hospitali...

The Child's Response to Hospitalization   The  factors influencing the response of  the child to hospitalization are the child's age, his personality, the preparation he receiv

Define intra enterocyte transport - non-haem iron absorption, Define Intra ...

Define Intra enterocyte transport - non-haem iron absorption? Intra enterocyte transport: In the enterocyte, the absorbed iron can have one of the following metabolic fates:

What is waist-to-hip ratio, What is Waist-to-Hip Ratio? Waist-to-Hip Ra...

What is Waist-to-Hip Ratio? Waist-to-Hip Ratio (WHR) is defined as the measurement of waist circumference divided by hip circumference. For example, if a person's waist measure

Mechanoreceptors - receptors, Mechanoreceptors - Receptors Mechanorece...

Mechanoreceptors - Receptors Mechanoreceptors involve those receptors involved in perception of touch, pressure, tension, hearing, vibration, gravity, muscle tension etc. Th

To study whether bacteria grow best where it is moist or dry, To study whet...

To study whether bacteria grow best where it is moist or dry Use 2 sterile dishes. Inoculate each one by touching a sterile transmit needle to a bacteria colony rowing in anoth

How water content influence the rs content, How Water content Influence the...

How Water content Influence the RS content? The yield of RS formed in heat-moisture treatment is closely related to water content, which may be an inherent component of food or

Explain adverse effects of fosamprenavir calcium, Explain adverse effects o...

Explain adverse effects of fosamprenavir calcium   Adverse effects are similar to those with amprenavir, but in clinical studies the incidence of nausea, vomiting and severe ra

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

The kidney.., where is the inlet and outlet of the diaylsis machine

where is the inlet and outlet of the diaylsis machine

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd