Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How does iodine kill germs?
The microbiocidal action of Iodine is because of the active form, I2, which is polarized by water and like all halogens (chlorine, fluorine, bromine, etc.), acts as an extremely potent oxidizer. Activated iodine (I2) reacts in electrophilic reactions with enzymes of the respiratory chain as well as with amino acids located in cell membrane and cell wall proteins.
Fat digestion requires two steps? What are the steps and what enzymes are used to accomplish each step?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In hospitals where many tuberculosis patients are treated the population of the tuberculosis mycobacteria may be constituted of multiresistant (to antibiotics) strains. How does th
Vibrio parahaemolyticus gastroenteritis While most other known food poisoning syndromes may be contracted from a variety of foods, V. parahaemolyticus gastroenteritis is contr
Q. Phylogenetic species concept ? Taxonomists (scientists who compare, classify and name organisms) tend to describe a species by studying their physical characteristics and be
how we attempt a question of phylum mollusca in exame?
Q. What is the difference between primary ecological succession and secondary ecological succession? The Primary ecological succession is the changing sequence of communities f
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Calculate the molar concentration of illinic acid and of its conjugate base illinate ion (in moles/L; M) in a 0.002 M illinate buffer at pH 12.0. The pKa of illinic acid is 6.7. En
Regarding the article "Baby Blues" which of the following is a false statement? A. Children, whose mothers underwent severe stressful episodes during pregnancy, have higher tha
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd