Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How does iodine kill germs?
The microbiocidal action of Iodine is because of the active form, I2, which is polarized by water and like all halogens (chlorine, fluorine, bromine, etc.), acts as an extremely potent oxidizer. Activated iodine (I2) reacts in electrophilic reactions with enzymes of the respiratory chain as well as with amino acids located in cell membrane and cell wall proteins.
An island may be colonised by just a few individuals, or just a pair:, or even a single gravid female. When a new population develops from these early colonisers of the island, the
The Child's Response to Hospitalization The factors influencing the response of the child to hospitalization are the child's age, his personality, the preparation he receiv
Define Intra enterocyte transport - non-haem iron absorption? Intra enterocyte transport: In the enterocyte, the absorbed iron can have one of the following metabolic fates:
What is Waist-to-Hip Ratio? Waist-to-Hip Ratio (WHR) is defined as the measurement of waist circumference divided by hip circumference. For example, if a person's waist measure
Mechanoreceptors - Receptors Mechanoreceptors involve those receptors involved in perception of touch, pressure, tension, hearing, vibration, gravity, muscle tension etc. Th
To study whether bacteria grow best where it is moist or dry Use 2 sterile dishes. Inoculate each one by touching a sterile transmit needle to a bacteria colony rowing in anoth
How Water content Influence the RS content? The yield of RS formed in heat-moisture treatment is closely related to water content, which may be an inherent component of food or
Explain adverse effects of fosamprenavir calcium Adverse effects are similar to those with amprenavir, but in clinical studies the incidence of nausea, vomiting and severe ra
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
where is the inlet and outlet of the diaylsis machine
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd