Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q How different is the amphibian heart from the fish heart?
The fish heart has only two chambers, a ventricle and an atrium, and the blood that comes to it is purely venous.
In amphibians there are three heart chambers a second atrium is present and there is arterial blood coming from the lungs; in these animals the heart has two atria one that gets blood from the body and other that gets blood from the lungs and one ventricle arterial blood mixes with venous blood within the ventricle which in turn pumps the blood to the lungs and to the systemic circulation.
Q. What is the structure that to maintains identical chromatids bound? The structure that to maintains identical chromatids bound is the centromere.
HACCP Control Measure HACCP Control Measure : Any action or activity that can be used to prevent, eliminate or reduce a significant hazard.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Surgical preparation of the bone - drill technique It is essential not to allow the bone to be heated above 47°C during preparation of the site as this will cause bone cell dea
List the goals of targeting blood pressure in diabetics. Goals of targeting blood pressure in diabetics are: Patients with diabetes should be treated to a systolic blood pr
One characteristic of the DNA molecule is its replication capability. What are the consequences of failures during DNA replication? Ideally a DNA molecule should replicate in a
what are the some examples of phlum protoza?
a) What is symbiotic nitrogen fixation? b) Name the two protein components required for this process. Define their role.
Explain the term Protoderm? The protoderm is one of the so-called "primary tissues" because it is formed first during germination and subsequent plant growth. The protoderm g
Shrub Stage - Xerarch Sufficient soil is formed in the herbs stage, for supporting the woody plants or the shrubs. They migrate with the help of seeds or rhizomes from the adj
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd