Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How Delayed Complementary Feeding Cause PEM?
The mothers from poorer socioeconomic groups where PEM is more prevalent, delayed introduction of complementary foods (foods in addition to breast milk) usually until the infant completes one year of age is n common practice. Thus, when breast milk is not adequate, delaying complementary feeding further aggravates the dietary inadequacy among such infants leading to PEM. US women, due to ignorance, finally believe that children should be given complementary foods only when they are able to pick and eat. After weaning (completely stopping breast feeding), the children are not given any special diet other than the adult diet. Young infants cannot consume these diets in adequate amounts due to its bulk. Early and abrupt weaning and introduction of diluted milk formulae is one of the reasons for marasmus.
Examine the differences between DNA and RNA. Explain why DNA is the most favorable molecule for genetic material and how RNA compares to it in this respect.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain congenital heart disease ? No systematic surveys have been conducted to estimate the incidence of CHD at birth in India and other developing countries. As a result ther
In humans, the recessive allele that causes a form of red-green colour blindness (c) is found on the X chromosome. a) Determine the genotypes and phenotypes of the F1 generation fr
What are the factors to an actual shift in the supply curve? Factors which cause an actual shift in the supply curve are described in below: When prices rise or fall this wo
Name the source gland of leutinising hormone (LH). State the other hormone along with which it acts on its target cells/organ. Give their two functions.
Individuals of the following genotype are crossed: aa BB Cc Dd (crossed with) Aa Bb Cc Dd A) How many different phenotypes are possible for the progeny? B) What are the chanc
Q. Concept of Development of binomial nomenclature? Name is a conventional tool to act as means of reference. For example, when we say chimpanzee, sparrow, paddy, virus, we mea
Prevention of flap dehiscence Flap margin dehiscence (separation) is prevented by approximating the edges of the flap over healthy bone by handling the edges of the flap gently
Coelom - Metazoa True coelom is a body cavity which arises within the embryonic mesoderm so that the cavity lies between the body wall (integument; ectoderm) and guts (endoder
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd