How delayed complementary feeding cause pem, Biology

Assignment Help:

How Delayed Complementary Feeding Cause PEM?

The mothers from poorer socioeconomic groups where PEM is more prevalent, delayed introduction of complementary foods (foods in addition to breast milk) usually until the infant completes one year of age is n common practice. Thus, when breast milk is not adequate, delaying complementary feeding further aggravates the dietary inadequacy among such infants leading to PEM. US women, due to ignorance, finally believe that children should be given complementary foods only when they are able to pick and eat. After weaning (completely stopping breast feeding), the children are not given any special diet other than the adult diet. Young infants cannot consume these diets in adequate amounts due to its bulk. Early and abrupt weaning and introduction of diluted milk formulae is one of the reasons for marasmus.


Related Discussions:- How delayed complementary feeding cause pem

Examine the differences between dna and rna, Examine the differences betwee...

Examine the differences between DNA and RNA. Explain why DNA is the most favorable molecule for genetic material and how RNA compares to it in this respect.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain congenital heart disease, Explain congenital heart disease ? No...

Explain congenital heart disease ? No systematic surveys have been conducted to estimate the incidence of CHD at birth in India and other developing countries. As a result ther

Determine the genotypes of parents, In humans, the recessive allele that ca...

In humans, the recessive allele that causes a form of red-green colour blindness (c) is found on the X chromosome. a) Determine the genotypes and phenotypes of the F1 generation fr

What are the factors to an actual shift in the supply curve, What are the f...

What are the factors to an actual shift in the supply curve? Factors which cause an actual shift in the supply curve are described in below: When prices rise or fall this wo

Name the source gland of leutinising hormone, Name the source gland of leut...

Name the source gland of leutinising hormone (LH). State the other hormone along with which it acts on its target cells/organ. Give their two functions.

Do progeny shows all of the dominant phenotypes, Individuals of the followi...

Individuals of the following genotype are crossed: aa BB Cc Dd (crossed with) Aa Bb Cc Dd A) How many different phenotypes are possible for the progeny? B) What are the chanc

Development of binomial nomenclature, Q. Concept of Development of binomial...

Q. Concept of Development of binomial nomenclature? Name is a conventional tool to act as means of reference. For example, when we say chimpanzee, sparrow, paddy, virus, we mea

State the prevention of flap dehiscence, Prevention of flap dehiscence ...

Prevention of flap dehiscence Flap margin dehiscence (separation) is prevented by approximating the edges of the flap over healthy bone by handling the edges of the flap gently

Coelom - metazoa, Coelom - Metazoa True coelom is a body cavity which ...

Coelom - Metazoa True coelom is a body cavity which arises within the embryonic mesoderm so that the cavity lies between the body wall (integument; ectoderm) and guts (endoder

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd