How computed tomography helps the doctors, Biology

Assignment Help:

Explain briefly how computed tomography (CT) helps the doctors in pinpointing the defects in the patient's body

Related Discussions:- How computed tomography helps the doctors

Types of changes encountered during the support phase, What are the types o...

What are the types of changes encountered during the Support phase Adaptation - To accommodate changes to its environment Correction - To uncover defects in the Software

Is cell division happening during the entire cell cycle, Is cell division h...

Is cell division happening during the entire cell cycle? What is interphase? Cell division properly happens during the mitotic phase of the cell cycle. During interphase proces

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain rickets, Explain Rickets Rickets:- A condition in children du...

Explain Rickets Rickets:- A condition in children due to vitamin D deficiency.

Explain about the food science and technology, Explain about the Food Scien...

Explain about the Food Science and Technology? Food Science and Technology are so inextricably linked that usually these are treated as one field of study. While Food Science d

Explain faecal coliforms - microbiological study of water, Explain the Faec...

Explain the Faecal Coliforms - Microbiological Study of Water? The faecal coliforms include a wide range of bacteria, many of which are not primarily the intestinal bacteria. T

What chemical is used to test for the presence of co2, What chemical is no...

What chemical is normally used to test for the presence of carbon dioxide? What is the result of the test if carbon dioxide is present? a) Lime water is used t

Explain about the iron - micro minerals, Explain about the Iron - Micro Min...

Explain about the Iron - Micro Minerals? Iron was a familiar metal even in the ancient civilization. In India, iron implements made their appearance in between 1300-1000 BC and

Formation of egg membrane, FORMATION OF EGG MEMBRANE Ovum with egg memb...

FORMATION OF EGG MEMBRANE Ovum with egg membrane is called ova / egg. On the basis of origin the egg membrane are of three types & 1 . PRIMARY EGG MEMBRANE It is

What is the function of the skin in humans, What is the function of the ski...

What is the function of the skin in humans? The skin is the external covering of the body. In humans its major functions are protection, perception of information from the envi

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages